1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
n200080 [17]
3 years ago
9

You find a population of strange cells in a sample of pond water. You wish to determine first whether they are eukaryotic or pro

karyotic. You look for a membrane-enclosed nucleus and don't see one, but sometimes the nucleus is hard to spot without staining. What else could you look for to determine which cell type this is?
Biology
1 answer:
Colt1911 [192]3 years ago
5 0

Answer:

Membrane bound cell organelles

Explanation:

A prokaryotic cell lacks a membrane defined nucleus and all the membrane-bound organelles. A eukaryotic cell has a membrane-bound nucleus and other membrane-bound organelles such as mitochondria, chloroplasts, endoplasmic reticulum, lysosomes, Golgi apparatus, etc.

To determine if a cell is a prokaryotic or eukaryotic, one can look for the nucleus and the membrane-bound organelles. If the cell has a nucleus and membrane-bound organelles, it is a eukaryotic cell. The absence of these structures makes it a prokaryotic cell.

You might be interested in
Cystic fibrosis is a devastating illness that affects the lungs, pancreas, and intestines.In 1989, researchers discovered that t
Natalka [10]

Answer:

There is no cure for cystic fibrosis, but treatment can ease symptoms and reduce complications.

Explanation:

1). For those with cystic fibrosis who have certain gene mutations, doctors may recommend a newer medication called ivacaftor. This medication may improve lung function and weight, increases the activity of Cystic fibrosis transmembrane conductance regulator (CFTR)protein and reduce the amount of salt in sweat. It has been approved by the Food and Drug Administration for people with cystic fibrosis who are age 6 and older. The dose depends on your weight and age.

2). For people with a certain gene mutation who are age 12 and older, another drug is available that combines ivacaftor with a medication called lumacaftor. This drug is called orkambi.

The use of Orkambi may improve lung function and reduce the risk of exacerbations.

I hope you're clear on this Daxxy

3 0
3 years ago
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
3 years ago
The red shperes represent oxygen atoms and the blue spheres represent hydrogen atoms. Is this substance?
grandymaker [24]
The substance is a compound because it's formed by two different elements.
5 0
4 years ago
Read 2 more answers
Functional Magnetic Resonance Imaging is a tool that has been very useful in identifying what parts of the brain do what. Scient
Ne4ueva [31]

Answer:

E. It takes a picture of the brain according to oxygen levels. More oxygen in an area indicates more activity in that area.

Explanation:

Haemoglobin is diamagnetic when oxygenated but paramagnetic when deoxygenated. This distinction in magnetic characteristics leads to tiny variations in the blood MR signal. Since blood oxygenation differs, these variations can be used to identify brain activity depending on the concentrations of neural activity.

4 0
3 years ago
PLEASE HELP ME ITS DUE TODAY PLEASE YOU DONT HAVE TO AWNSER THEM ALL
dybincka [34]

Answer:

1 = A

2 = B

3 =  B

Explanation:

1) Black holes occur when really big stars collapse on themselves. And, in order to get big, the star has to be an old one.

2) A black hole is something huge that swallows up everything, while a protostar is just the very beginning of a star.

3) Scientist can't truly know for sure, but they can infer about them due to the effects of the surrounding areas.

7 0
3 years ago
Other questions:
  • Form a hypothesis that describes how plants such as vines benefit from thigmotropism
    15·1 answer
  • Describe the structure and function of transfer RNA (tRNA).
    13·1 answer
  • Drag each tile to the correct location
    12·1 answer
  • Living organisms, and all matter, are made of _____.
    11·2 answers
  • If a corn plant has a genotype of Ttyy, what are the possible genetic combinations that could result in a single grain of pollen
    8·2 answers
  • How does gene flow prevent a population for adapting to its environmenta
    7·1 answer
  • Can someone help pls​
    11·1 answer
  • Answer with anything, ill give you brainliest (no question)​
    15·1 answer
  • Using the explicit formula, calculate how far the students will be swimming on week 10 using Ernest's schedule.
    6·1 answer
  • Squids, which are members of phylum mollusca, use an anatomical structure called a siphon for locomotion, feeding, respiration,
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!