1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tomtit [17]
2 years ago
8

Georgio is jogging barefoot along the beach when he suddenly steps on the sharp edge of a broken shell. he instantly feels pain

due to the message carried to his brain by ____. he then slowly walks home with an achy foot. the message of the ache is carried b
Biology
1 answer:
ikadub [295]2 years ago
6 0
<span>Georgio instantly feels pain due to the message carried to his brain by </span>myelinated axons.  The message of the ache is carried by unmyelinated axons.
The myelinated axon is highly "insulated" axon that r<span>eceives input and transmit impulse quickly.</span>
The purpose of the naked axon with larger dendritic field which is called unmyelinated axon is to receive as much input as possible.

You might be interested in
Earth's dynamic processes allow our planet to recycle:
adoni [48]
The answer for this question would be choice <span>B) Water, rock, and surface materials, or the second option.</span>
6 0
3 years ago
Read 2 more answers
What did the Clean Air Act of 1970 permit U.S. citizens to do for the first time?
vaieri [72.5K]
I think B is the answer The Clean Air Act That prevented air pollution and protected the ozone layer as well as promote public health. This act gave Enviromen. Protection Agency the power to take effective action fighting environmental air pollution
8 0
3 years ago
How would the removal of keystone species affect an ecosystem's biodiversity
klasskru [66]
The keystone species is the one at the bottom of the pyramid, if we look at it like a pyramid. If the grass dies, then the deer cannot get food and die, and the predator cannot eat and dies, and the whole ecosystem can fall apart.
7 0
3 years ago
An enzyme is a large ________ molecule.
IRINA_888 [86]
And enzyme is a large protein molecule.
4 0
2 years ago
Read 2 more answers
What is true of all eukaryotes
Eddi Din [679]
Eukaryotic cells are larger than prokaryotic cells and have a “true” nucleus, membrane-bound organelles, and rod-shaped chromosomes. The nucleus houses the cell's DNA and directs the synthesis of proteins and ribosomes
6 0
2 years ago
Read 2 more answers
Other questions:
  • How many milliliters of a 2 M solution would contain 1 mole of sucrose?
    10·1 answer
  • How do life forms change over time
    14·1 answer
  • ____________from the Sun is not matter, although you can see it.<br><br> Fill in the blank
    8·2 answers
  • The visual cliff is a laboratory device for testing ________ in infants.
    12·1 answer
  • Define what is meant by causal association according to Hill's criteria. From your own experiences, give an example of how the 3
    7·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Please help me.. I'm on a quiz!!! Explain how many ancient and medieval societies forwarded marine science even though they were
    13·2 answers
  • Will turtles become extinct
    5·2 answers
  • What types of rocks do the numbers 2, 3, and 5 represent, in that order?
    8·2 answers
  • a suspension of yeast cells is being grown under anaerobic conditions such that glucose is degraded to ethanol and carbon dioxid
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!