1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
gtnhenbr [62]
3 years ago
12

GTA: TAA mRNA UCA : CAU: AUU tRNA AGU : GUA : UAA rRNA Serine Valine Stop You need to solve the entire DNA line and then answer

the even numbered question below. 1) DNA GTA ATG AGT CAC CTG GCC GTA AAA CCT TAT AGA TAA ATC mRNA tRNA TRNA 2) 3) DNA mRNA tRNA rRNA 4) How many proteins were produced? ( ) TGAAGACCCATTATGTGCCTGTAATACCCAAGCTAGAAG How many proteins were​

Biology
1 answer:
AlekseyPX3 years ago
8 0

Answer:

u want step by step?

Explanation:

You might be interested in
Which is not true of gene expression?
MrRissso [65]

In simple terms, Gene expression can be stated as the process by which the heredity details in a gene sequence a be made into a functional gene.

<u>Explanation:</u>

  • The odd one for this question is probably would be "it occurs because of cellular signals within your body".
  • It explains how a cell functions. In Gene expression, the gene encodes the protein and the message from DNA to RNA gives the cell functions.
  • It is the specific combination of genes that are turned on or off. It can be stated as the process of turning off and turning on, it acts as a switch to on and off it is known as the gene expression or gene regulation.
  • It creates different DNA within each of your cell types. The unique design of gene expression results in unique and different combinations of proteins and makes each cell types.

3 0
3 years ago
Organisms may play only one role in an ecosystem true or false
anyanavicka [17]
This is false. Organisms may play several important roles in an ecosystem. Consider for example and ocean shore environment occupied by a particular species of crab. The crabs are scavengers and eat any organic matter they encounter. They therefore play an important role in the cycling of nutrients in the ecosystem. The crabs are however also an important source of food for a range of other species occupying the same habitat, including octopi, certain fishes and sea otters. Therefore, the crabs are an important part of the food web in the ecosystem. Many species similarly occupy multiple important roles in an ecosystem.
4 0
3 years ago
In a family with two brothers, one brother's thumbs are straight while the
SpyIntel [72]

Answer:

The brothers have different alleles.

Explanation:

4 0
3 years ago
The accuracy of a measurement​
Marianna [84]

Answer:

The comparison of a measurement with a known standard, used to determine whether the measurement is reliable. Measurement accuracy is identified as the difference between the measurement of a factor and the accepted value for that factor from a trusted external source, or the percentage by which the two values differ.

Explanation:

5 0
3 years ago
Read 2 more answers
Which student’s measurement is more accurate? Why?
Anastaziya [24]

Answer:

Student B

Explanation:

They used to units of measurement to verify there answer.

Fist student rounded so its an estimate of the answer but second student verified with millimetes and cm.

Also its physics lol or maybe math.

8 0
2 years ago
Read 2 more answers
Other questions:
  • How many distinct stages must occur between the point when light first encounters chlorophyll and the point at which
    15·2 answers
  • In which step of the diagram does the virus release a protein that causes the cell wall to burst?
    11·2 answers
  • SHERIFF. Nothing here but kitchen things. (The County Attorney, after again looking around the kitchen, opens the door of a cupb
    11·2 answers
  • Which of these categories of Linnaean classification contains all the others?
    15·1 answer
  • Would the surface temperature of white dwarf stars be higher or lower than red supergiants?
    15·2 answers
  • 4. Explain how the structure of a bacterial cell differs from the structure of the cells in
    14·1 answer
  • This racoon is very cool
    8·2 answers
  • If you do not have an adequate level of fat in your body, you might have trouble
    13·1 answer
  • Why is sustainable use of natural resources important?
    13·1 answer
  • What factors determine if a species is fit to survive?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!