1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
gtnhenbr [62]
3 years ago
12

GTA: TAA mRNA UCA : CAU: AUU tRNA AGU : GUA : UAA rRNA Serine Valine Stop You need to solve the entire DNA line and then answer

the even numbered question below. 1) DNA GTA ATG AGT CAC CTG GCC GTA AAA CCT TAT AGA TAA ATC mRNA tRNA TRNA 2) 3) DNA mRNA tRNA rRNA 4) How many proteins were produced? ( ) TGAAGACCCATTATGTGCCTGTAATACCCAAGCTAGAAG How many proteins were​

Biology
1 answer:
AlekseyPX3 years ago
8 0

Answer:

u want step by step?

Explanation:

You might be interested in
How are plant cells different from animal cells?
Aleksandr [31]

Answer:

Answers are as follows

A

C

D

Explanation:

8 0
3 years ago
Which pathway would be used during a one minute steep climb
Fiesta28 [93]
It would be glycogen, after reading the article from the science learning hub.
7 0
3 years ago
Read 2 more answers
Ave de la familia de los faisanes
bezimeni [28]
<span>the answer is:

 the Pheasant</span>
6 0
3 years ago
What are the steps in filament theory
Inessa [10]

Answer and Explanation:

The steps of the sliding filament theory are:

Muscle activation: breakdown of energy (ATP) by myosin.

Before contraction begins, myosin is only associated with a molecule of energy (ATP), which myosin breaks down into its component molecules (ADP + P) causing myosin to change shape.

Muscle contraction: cross-bridge formation

The shape change allows myosin to bind an adjacent actin, creating a cross-bridge.

Recharging: power (pulling) stroke

The cross-bridge formation causes myosin to release ADP+P, change shape, and to pull (slide) actin closer to the center of the myosin molecule.

Relaxaction: cross-bridge detachment

The completion of the pulling stroke further changes the shape of myosin. This allows myosin and ATP to bind, which causes myosin to release actin, destroying the cross-bridge. The cycle is now ready to begin again.

The repeated cycling through these steps generates force (i.e., step 2: cross-bridge formation) and changes in muscle length (i.e., step 3: power stroke), which are necessary to muscle contraction.

7 0
3 years ago
During the process of only specific parts of the DNA are activated; the parts of the DNA that are activated
kenny6666 [7]

Answer B And C

The decoding of information in a cell's DNA into proteins begins with a complex ... use different sets of catalysts to express only specific portions of these instructions to ... that the process of DNA replication be as accurate as possible (Figure 1). ... number depends on how active a particular cell is in synthesizing proteins.

Explanation:

8 0
3 years ago
Other questions:
  • The bacterium Bacillus anthracis, which causes anthrax, has been developed as a biological warfare agent.
    15·1 answer
  • Describe the notation Tt for the trait of being tall?
    12·1 answer
  • Which of the following structures is NOT found in bacteria?
    12·2 answers
  • What is "slab-push"? Can some Give me one example of a slab-push structure.
    12·1 answer
  • In the nitrogen cycle, bacteria that live in soil and on plant roots in a symbiotic relationship with legumes change nitrogen ga
    10·1 answer
  • The bulk of the atp for aerobic exercise comes from the oxygen-requiring process of _____.
    5·1 answer
  • Is red and brown algae more closely related to green algae ?
    6·1 answer
  • In a cell undergoing meiosis, during which stage do the sister chromatids separate from each other?
    9·1 answer
  • Helppppp will mark brainliest!!!!!
    12·2 answers
  • Cells without a nucleus are
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!