1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
gtnhenbr [62]
3 years ago
12

GTA: TAA mRNA UCA : CAU: AUU tRNA AGU : GUA : UAA rRNA Serine Valine Stop You need to solve the entire DNA line and then answer

the even numbered question below. 1) DNA GTA ATG AGT CAC CTG GCC GTA AAA CCT TAT AGA TAA ATC mRNA tRNA TRNA 2) 3) DNA mRNA tRNA rRNA 4) How many proteins were produced? ( ) TGAAGACCCATTATGTGCCTGTAATACCCAAGCTAGAAG How many proteins were​

Biology
1 answer:
AlekseyPX3 years ago
8 0

Answer:

u want step by step?

Explanation:

You might be interested in
Select the correct answer.
viva [34]

Answer:

C

Explanation:

3 0
3 years ago
A doctor might treat a patient with cancer by giving the patient ____________________, which are drugs that can kill cells that
jonny [76]
The answer is Chemotherapy 
3 0
3 years ago
Give an example of temporal isolation and explain how temporal isolation is preventing reproduction within the population.
bonufazy [111]

Various cicada species erupt to reproduce at various times. A prime example of temporal isolation is this. The frog species Rana aurora and Rana boylii exhibit temporal isolation as a result of variations in seasonal breeding. Although both species live in the same geographic areas, their mating seasons are different.

<h3>What is temporal isolation ?</h3>

When many species reproduce at various periods, there is a condition known as temporal isolation. Three different orchid species, for instance, coexist in the same rain forest. Every species contains flowers that only bloom for a single day and need to be pollinated on that day in order to generate seeds.

  • Due to differences in fertility or mating timing, such as having various mating seasons, species cannot interbreed due to temporal isolation. Due to different mating practises or rituals, behavioural isolation prevents species from interbreeding.

Learn more about Temporal isolation here:

brainly.com/question/469933

#SPJ4

3 0
1 year ago
New oceanic lithosphere is unable to form at mid-ocean ridges. Please select the best answer from the choices provided T F
miss Akunina [59]
New oceanic lithosphere is unable to form at mid ocean ridges. This is False. New oceanic lithosphere is able to form at mid-ocean ridges. This is where the New oceanic lithosphere is usually formed
8 0
3 years ago
Read 2 more answers
What is created when plants convert the sun's energy?
nydimaria [60]

Answer: Photosynthesis

Explanation:

4 0
3 years ago
Read 2 more answers
Other questions:
  • A lawn sprinkler is a compound machine?
    15·1 answer
  • What happens direcly after metephse
    10·1 answer
  • Jill takes her children to play in the park every afternoon. She notices that since the city changed their landscaping service,
    14·2 answers
  • By which process do human liver cells regenerate themselves cells
    9·2 answers
  • I need help with this question. Anybody wanna help?
    8·1 answer
  • When essential nutrients are depleted some genre of bacteria ​
    13·1 answer
  • These are biochemical processes of an organism
    5·1 answer
  • What are the functions of the male reproductive system?
    7·2 answers
  • What form of matter is made from only one type of atom?
    8·2 answers
  • Some rocks are formed from _______ that erupts from volcanoes as lava.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!