1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
gtnhenbr [62]
3 years ago
12

GTA: TAA mRNA UCA : CAU: AUU tRNA AGU : GUA : UAA rRNA Serine Valine Stop You need to solve the entire DNA line and then answer

the even numbered question below. 1) DNA GTA ATG AGT CAC CTG GCC GTA AAA CCT TAT AGA TAA ATC mRNA tRNA TRNA 2) 3) DNA mRNA tRNA rRNA 4) How many proteins were produced? ( ) TGAAGACCCATTATGTGCCTGTAATACCCAAGCTAGAAG How many proteins were​

Biology
1 answer:
AlekseyPX3 years ago
8 0

Answer:

u want step by step?

Explanation:

You might be interested in
Why does every one have cells
jeyben [28]
<span>Everyone has cells because these are the building blocks of life. These tiny particles that clump into groups that form tissues, organs, and organ systems are what makes organisms distinct from non-living things that exist on Earth. Where there are cells, life is present, and in its absence life cannot exist as we know of today. Cells are responsible for bringing different species of organisms that are found in different ecosystems all over Earth. They are tiny but in groups they are responsible for every living organisms that have existed through time.  </span>
7 0
3 years ago
According to appearances, which light produces the healthiest plant?
Dennis_Churaev [7]

Answer:

Blue light

Adding 10-20% blue light allowed plants to grow much healthier, with a compact appearance. There is also far-red light which is has wavelengths that are lower than normal red light–similar to near-infrared wavelengths. Far-red light helps the plants produce greater yields.

3 0
3 years ago
What is the main purpose of the digestive system
DENIUS [597]

Answer:

to digest the food

Explanation:

The main purpose of the digestive is to get the nutrients out of the food that you eat. When you eat something, it goes through the digestive system to get the fuel and nutrients from the food that you eat.

6 0
3 years ago
Do you think some of the organisms are more closely related than others? Explain your answer.
Rzqust [24]
Some organisms may be very closely related, even though a minor genetic change caused a major morphological difference to make them look quite different. For example, chimpanzees and humans, the skulls of which are shown in Figure 12.2. 2 are very similar genetically, sharing 99 percent1 of their genes. Hope this helps! Mark brainly please!
5 0
3 years ago
Read 2 more answers
In G₁ and G₂, what does G stand for?
Marysya12 [62]
I think it stands for Gap. Do you mean G1 and G2 interphases?
7 0
3 years ago
Other questions:
  • Generally saturated fats increase serum ldl cholesterol, with the possible exceptions of
    13·1 answer
  • Need help ??? Someone plis
    9·2 answers
  • What happens to water when it changes to ice?
    14·2 answers
  • Why do mushrooms grow back in the same spot each year even if someone removes the cap and stem of the mushroom?
    10·1 answer
  • During protein synthesis, what part of RNA is removed?
    8·2 answers
  • Why was it important for Miller and Urey to sterilized the apparatus to kill any bacteria in it?
    8·1 answer
  • Oxygen was into ally created in earths atmosphere by___.
    8·2 answers
  • How many hydrogen atoms are contained in a singleolecule of sucrose A, 6 B,12 C,22 D,24​
    8·1 answer
  • Explain blood curculation in human body in brief (in 100 words)​
    7·1 answer
  • Todos os animais herbívoros são mamiferos?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!