1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
gtnhenbr [62]
3 years ago
12

GTA: TAA mRNA UCA : CAU: AUU tRNA AGU : GUA : UAA rRNA Serine Valine Stop You need to solve the entire DNA line and then answer

the even numbered question below. 1) DNA GTA ATG AGT CAC CTG GCC GTA AAA CCT TAT AGA TAA ATC mRNA tRNA TRNA 2) 3) DNA mRNA tRNA rRNA 4) How many proteins were produced? ( ) TGAAGACCCATTATGTGCCTGTAATACCCAAGCTAGAAG How many proteins were​

Biology
1 answer:
AlekseyPX3 years ago
8 0

Answer:

u want step by step?

Explanation:

You might be interested in
A function of another type of white blood cell is to
Lyrx [107]
The main function of white blood cells is to help protect the human body from infection as well as other foreign materials. White blood cells are also known as leukocytes, and they develop in bone marrow from stem cells. There are five different types of white blood cells<span>, including neutrophils, lymphocytes, monocytes, eosinophils and basophils.</span>
4 0
3 years ago
How do scientists obtain knowledge about the world?
Sphinxa [80]
Well, scientists depend on science.They use the process of observation. But there are processes for these. The processes are;
Asking a question; Scientists wonder how specific happenings can be explained, they look for an answer.
They perform research; the scientists study the  particular thing, and look for reasons for a particular happening.
They form a hypothesis; a hypothesis is a statement which is not universally true, they are observations that haven't been agreed upon.
They test their hypothesis; they perform experiments to find out if their hypothesis is true.
They analyse the data and draw a conclusion; they record their hypothesis and write down their end result.
They pass across their result; they pass their new observation across to other people.
    Hope i helped. Have a nice day. 
7 0
3 years ago
Read 2 more answers
(03.02 LC)Which of the following correctly describes the law of conservation of energy?
kodGreya [7K]

The law of conservation of energy is a law of science that states that energy cannot be created or destroyed, but only changed from one form into another or transferred from one object to another. Hope it helps


5 0
3 years ago
Read 2 more answers
Would you expect human DNA to be more closely related to tiger or jellyfish? Explain.
worty [1.4K]

Answer:

I would expect a tigers' DNA to be more like humans DNA because a tiger has more characteristics like humans.

Explanation:

after all, tigers are mammals and jellyfish are aquatic invertebrates.

5 0
3 years ago
Fossils are ____
horsena [70]
Fossils are Remains Of Tracers Of Prehistoric Life
5 0
3 years ago
Read 2 more answers
Other questions:
  • the type of wound healing that occurs when a wound is sutured is what healing second intention or third intention or first inten
    7·1 answer
  • Which of the following partially determines the amount of energy carried by a water wave?
    5·1 answer
  • Which of the following is NOT an example of a graphic indicator which can help you understand the main purpose of a text? A. Sub
    5·1 answer
  • Nilai suhu reamur ke fahrenheit
    9·1 answer
  • Which of these conclusions is correct about P and Q in the diagram?
    10·1 answer
  • What is the difference between endarch and exarch?
    14·1 answer
  • The portion of the stomach closest to the duodenum is called the ________.
    8·1 answer
  • 3. Which of the following statements is not part of modern cell theory? A. All living things are made up of multiple cells. B. A
    11·1 answer
  • Which of the following ideas of modern systematics was not part of Linnaeus's traditional classification?
    15·1 answer
  • Does the trait vary among individuals in the population?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!