1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
gtnhenbr [62]
2 years ago
12

GTA: TAA mRNA UCA : CAU: AUU tRNA AGU : GUA : UAA rRNA Serine Valine Stop You need to solve the entire DNA line and then answer

the even numbered question below. 1) DNA GTA ATG AGT CAC CTG GCC GTA AAA CCT TAT AGA TAA ATC mRNA tRNA TRNA 2) 3) DNA mRNA tRNA rRNA 4) How many proteins were produced? ( ) TGAAGACCCATTATGTGCCTGTAATACCCAAGCTAGAAG How many proteins were​

Biology
1 answer:
AlekseyPX2 years ago
8 0

Answer:

u want step by step?

Explanation:

You might be interested in
Using the s-p timing method, epicenters can be located using seismograms from a minimum of ______ recording stations.
KATRIN_1 [288]

The SP timing method is a technique, which is useful for finding the epicenter of the earthquake. The Seismograph at a particular station shows the S and the P waves. The difference between the S and the P waves can be used to determine the distance, which waves have travelled in order to reach the seismic station.

The distance obtained is the distance of the epicenter from that seismic station, in order to determine the epicenter the circle is drawn in the map keeping the seismic center at the center. Same process is done by three or more seismic centers. The point, where the circle drawn by three or more seismic centers meet is considered as the epicenter.

Hence, the correct answer is Three.

7 0
3 years ago
Darwin’s studies of finches on the Galápagos Islands suggest that the finches’ differences in beak structure were most likely di
mylen [45]

Due to the finches' habitat and their how they have to adapt to it. If there were different ways of eating etc, they would have a different styled beak to suit that adaptation.

Hope it helps.

7 0
3 years ago
The resonators are the mouth, nose, and lips. true or false?
galina1969 [7]
The answer is false. Hope this helps
3 0
3 years ago
Read 2 more answers
The image shows a bean-shaped bacterium with long tail-like projections streaming from it.
Leto [7]
I'd also say that the morphology presented in this picture is filamentous.
The reason for my believing this is that filamentous morphology concerns long visible chains, threads, or filaments, which you can see in the image.
8 0
3 years ago
Read 2 more answers
A plant cell has lost too much water due to evaporation by the sun. It needs more water from other cells. What structure would a
Maru [420]
Normally it’s the plasmodesmata that allows exchange of molecules between adjacent cells. But I’m still not sure if water is included!
3 0
2 years ago
Read 2 more answers
Other questions:
  • Compared with deciduous forests, coniferous forests _____. tend to contain more broadleaf evergreen trees are more likely to be
    14·2 answers
  • A segment of a DNA strand is GTC TAG. Which of
    8·2 answers
  • Gunther touched a hot object and received a minor burn. How did the skeletal system help prevent further damage?
    14·2 answers
  • Evolution that occurs over a long period of time is called
    10·1 answer
  • Which statement best describes the data? PLEASE help i dont get this
    14·1 answer
  • Where in an equation for photosynthesis does carbon dioxide belong
    12·1 answer
  • What are some effective ways to clean-up polluted water? Support your answer
    9·1 answer
  • Axons are classified into three major groups called A, B, and C, based on their ____________ . Group A has a conduction velocity
    10·1 answer
  • ________ development involves growth and changes in the body and brain, the senses, motor skills, and health and wellness. a cog
    10·1 answer
  • The diatoms below are magnified 400x. To find the total magnification while looking under a microscope, you must multiply the po
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!