1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
gtnhenbr [62]
2 years ago
12

GTA: TAA mRNA UCA : CAU: AUU tRNA AGU : GUA : UAA rRNA Serine Valine Stop You need to solve the entire DNA line and then answer

the even numbered question below. 1) DNA GTA ATG AGT CAC CTG GCC GTA AAA CCT TAT AGA TAA ATC mRNA tRNA TRNA 2) 3) DNA mRNA tRNA rRNA 4) How many proteins were produced? ( ) TGAAGACCCATTATGTGCCTGTAATACCCAAGCTAGAAG How many proteins were​

Biology
1 answer:
AlekseyPX2 years ago
8 0

Answer:

u want step by step?

Explanation:

You might be interested in
If an organism has 24 chromosomes in each body cell, how many chromosomes would you expect to find in the organisms sex cells?
olya-2409 [2.1K]
The answer is 12 because when you add up 12 and 12 it equals to 24
8 0
3 years ago
What organism usually fixes nitrogen into usable chemical forms?
BigorU [14]
Bacteria found in the roots of legumes(beans) do nitrogen fixation.
4 0
2 years ago
What factors do you think have contributed to the growing wolf populations?
Trava [24]
  • Reproduction
  • Abundance of prey
  • Reduction in hunting

Hope this helped, have a great day <3

5 0
2 years ago
4. A frog has been brought into the rehabilitation clinic and seems to have reddened
viktelen [127]

Answer:

look for any bleeding or sores. look at the red legs. diagnosis with red leg disease. prescribe antibiotics orally. follow up in a week. meanwhile keep the frog away from other frogs.

Explanation:

5 0
2 years ago
Cocaine exerts its pleasurable effects on the brain by:
Semenov [28]

It disconnects the brain's dopamine system.

Further explanation

Cocaine

Cocaine is a capably addictive stimulant medication. For a great many years, individuals in South America have bitten and ingested coca leaves which is source of cocaine, for their stimulant effects. In the mid-1900s, refined cocaine was the primary dynamic fixing in numerous tonics and elixirs created to treat a wide assortment of diseases and was even a fixing in the early plans of Coca-Cola. Prior to the advancement of manufactured specialists utilized cocaine for the relief of pain. However, examine has since demonstrated that cocaine is an effectively addictive substance that can change cerebrum structure and capacity whenever utilized over and over.

Functions of cocaine

It shows very quickly effect after a solitary portion and vanish inside a couple of minutes to 60 minutes. Limited quantities of cocaine for the most part make the person feel euphoric, enthusiastic, loquacious, rationally caution, and easily affected to sight, sound, and contact. The medication can likewise briefly diminish the requirement for sustenance and sleep. Some clients find that cocaine encourages them perform straightforward physical and scholarly assignments all the more rapidly, in spite of the fact that others experience the contrary impact.

Effect of cocaine on dopamine

Cocaine particles block the dopamine transporters which shut down the neuron's capacity to take-up the additional dopamine inside the synaptic parted. This outcomes in expanded degrees of the synapse dopamine present in the extracellular spaces among these neurons.

Answer details

Subject: Biology

Level: College

Key words

  • Cocaine
  • Functions of cocaine
  • Effect of cocaine on dopamine

Learn more to evaluate

brainly.com/question/12887489

brainly.com/question/10560288

brainly.com/question/12603071

7 0
2 years ago
Read 2 more answers
Other questions:
  • Receptors that are __________ bind to chemicals outside of the cell, and this binding process causes a chemical response on the
    5·1 answer
  • Which of the following statements about the Bohr effect are true? This is the effect of pH on the binding of O2 to Hb. As blood
    12·1 answer
  • What is the term used to discribe an ecological community in which moisture and temperature is high
    5·1 answer
  • PLEASE HELP!
    11·1 answer
  • is the study of the blood and blood diseases. A. Genealogy B. Dermatology C. Hematology D. Neurology
    9·2 answers
  • 28. Select all accurate statements
    9·2 answers
  • Please select the word from the list that best fits the definition
    11·2 answers
  • Who receives the least energy from the sun food web/food chain
    13·1 answer
  • In Leonardo da Vinci’s time, nobody knew that the arteries were joined to the veins by tiny, invisible capillaries. This means t
    15·1 answer
  • Can someone pls help me<br> WILL MARK U BRAINLIEST !!
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!