1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
gtnhenbr [62]
3 years ago
12

GTA: TAA mRNA UCA : CAU: AUU tRNA AGU : GUA : UAA rRNA Serine Valine Stop You need to solve the entire DNA line and then answer

the even numbered question below. 1) DNA GTA ATG AGT CAC CTG GCC GTA AAA CCT TAT AGA TAA ATC mRNA tRNA TRNA 2) 3) DNA mRNA tRNA rRNA 4) How many proteins were produced? ( ) TGAAGACCCATTATGTGCCTGTAATACCCAAGCTAGAAG How many proteins were​

Biology
1 answer:
AlekseyPX3 years ago
8 0

Answer:

u want step by step?

Explanation:

You might be interested in
A zoologist analyzes the jawbones of an extinct mammal and concludes that it was an herbivore. The zoologist most likely came to
tekilochka [14]

A zoologist analyzes the jawbones of an extinct mammal and concludes that it was an herbivore. The zoologist most likely came to this conclusion based on the shape of the teeth.

Animals that consume plants, such as deer, elephants, cows, and many others, are known as herbivores. They eat a range of vegetables, fruits, grasses, grains, and other foods depending on the habitat of the specific animal, hence they are essentially vegetarians.

The broad, flat teeth of herbivores are perfect for chopping up the plant material they consume. These animals' teeth enable them to break down the fibers in their food, making it much simpler for them to digest.

Plant-eating animals known as herbivores have large, flat molars and sharp incisors. They don't own any dogs. The incisors, canines, and molars of omnivores are used for a range of foods. The teeth of herbivores are designed to crush and ground vegetation.

To learn more about herbivores refer to:

brainly.com/question/14480770

#SPJ4

8 0
1 year ago
What are stem cells? Where are they found?
Debora [2.8K]
Following the treatment, the Fetal Stem Cells will travel throughout the body, detecting damaged cells and tissue and attempts to restore them. The Fetal Stem Cells can also stimulate existing normal cells and tissues to operate at a higher level of function, boosting the body’s own repair mechanisms to aid in the healing process. These highly adaptive cells then remain in the body, continually locating and repairing any damage they encounter.
4 0
3 years ago
Which of the following best describes a new molecule of
meriva
It would be the first choice :)
Because when replicating DNA, this process is called semi-conservative
Hope this helps :)
~His Cookie Monster
8 0
3 years ago
7) The main result of photosynthesis is A) global warming. B) food production. C) carbon dioxide production. D) decreased atmosp
kenny6666 [7]

Answer:

B, food production

Explanation:

The plant is producing food for itself

8 0
3 years ago
Read 2 more answers
What might occur when mitosis is not stopped or occurs quickly due to the presence of cancer.  
leva [86]
In a cell, there are several parts of it that are there to stop this from happening. Cancerous cells do not have the genetic code to stop growing and reproducing. A regular cell will actually destroy itself it there is a mutation. If it does not get destroyed, it could potentially be tumorous, then it could eventually be cancerous.

4 0
3 years ago
Other questions:
  • Where do stinging insects go when they're sick?
    7·1 answer
  • What type of functional area of the cerebral cortex would be responsible for sending impulses that control skeletal muses?
    6·1 answer
  • Assuming the carbon cycle is a closed system, which of the following statements is true?
    11·2 answers
  • Outline the effect of CFCs on the ozone layer.
    8·1 answer
  • Why do sperm cells contain so many mitochondria?
    12·1 answer
  • What are the reactants of photosynthesis? Check all that apply.carbon dioxideglucoseoxygenwater
    7·1 answer
  • The picture below shows a cell undergoing a
    10·1 answer
  • A scientist observes a cell that is surrounded by a cell wall and that lacks a nucleus and membrane-bound organelles. what can t
    12·1 answer
  • Most plants have different colors in the fall because ________.
    8·1 answer
  • What causes depersonalization of a nueron membrain potential?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!