1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
gtnhenbr [62]
2 years ago
12

GTA: TAA mRNA UCA : CAU: AUU tRNA AGU : GUA : UAA rRNA Serine Valine Stop You need to solve the entire DNA line and then answer

the even numbered question below. 1) DNA GTA ATG AGT CAC CTG GCC GTA AAA CCT TAT AGA TAA ATC mRNA tRNA TRNA 2) 3) DNA mRNA tRNA rRNA 4) How many proteins were produced? ( ) TGAAGACCCATTATGTGCCTGTAATACCCAAGCTAGAAG How many proteins were​

Biology
1 answer:
AlekseyPX2 years ago
8 0

Answer:

u want step by step?

Explanation:

You might be interested in
O type blood contains what type of antibodies?
motikmotik
O type blood contains both A and B antibodies.
6 0
2 years ago
Read 2 more answers
What two body systems interact when blood filters through the kidneys for purification and the waste is removed
DaniilM [7]
The kidneys ureters, bladder, and urethra make up the urinary system. They all work together to filter, store and remove liquid waste for your body. Hope this helps have a great day
6 0
3 years ago
Read 2 more answers
Dr. Paul Ehrlich observed that the differential stain developed by Dr. Gram suggested bacteria could be killed differentially by
Illusion [34]

Answer:

d. Ribosome

f. Cell wall

Explanation:

In humans 80s type of ribosome is present and in bacteria 70s type of ribosome is present. Human cells do not have cell wall while bacterial cells have peptidoglycan cell wall. These differences can be targeted by the potential antibacterial agents.

For example, tetracycline antibiotic inhibits the binding of important molecules to bacterial ribosome which ultimately inhibits the protein synthesis in bacteria. Vancomycin antibiotic on other hand inhibits the cell wall formation in bacteria by inhibiting peptidoglycan synthesis.

8 0
3 years ago
What is a green plant supported by so it can stand up? water osmotic pressure cell walls
tiny-mole [99]

Answer:

Cell walls

Explanation:

Water is not it, as liquids usually serve no supportive value.

Osmotic pressure is, "the pressure that would have to be applied to a pure solvent to prevent it from passing into a given solution by osmosis, often used to express the concentration of the solution." (Google Dictionary)

Cell walls are rigid shells on the outside of most plants which helps them stay rigid.

5 0
3 years ago
Read 2 more answers
However, there are some ethical issues surrounding the mapping of individual genomes. One concern is
KengaRu [80]

There is not that much information, so it is impossible to answer this question. I apologise.

4 0
2 years ago
Other questions:
  • An atom with how many electrons in its outer shell is most stable? A) 1 B)4 c) 8 or d) 10
    6·1 answer
  • If a pair of organisms are capable of producing fertile offspring in nature, they must belong to the same A) class B) kingdom C)
    7·2 answers
  • The modification of proteins occur in which organelle of the cell ...?
    15·1 answer
  • Two adjacent neurons that communicate with one another are separated by a space. what is this space called?
    5·1 answer
  • An example of multiple allelism in humans is A) albinism. B) cystic fibrosis. C) ABO blood groups. D) sickle cell disease
    11·1 answer
  • All the biotic and abiotic factors in a particular area
    12·2 answers
  • Imagine a type of plant that people could eat as food, BUT it was
    11·1 answer
  • What is a point of view?​
    14·2 answers
  • Which section of the scientific manuscript presented in the case study on sandbar sharks defined young-of-year as sharks less th
    14·1 answer
  • in its second messenger role, cAMP activates enzymes called ____________, whose jobs is to regulate other enzymes by adding phos
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!