1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
gtnhenbr [62]
3 years ago
12

GTA: TAA mRNA UCA : CAU: AUU tRNA AGU : GUA : UAA rRNA Serine Valine Stop You need to solve the entire DNA line and then answer

the even numbered question below. 1) DNA GTA ATG AGT CAC CTG GCC GTA AAA CCT TAT AGA TAA ATC mRNA tRNA TRNA 2) 3) DNA mRNA tRNA rRNA 4) How many proteins were produced? ( ) TGAAGACCCATTATGTGCCTGTAATACCCAAGCTAGAAG How many proteins were​

Biology
1 answer:
AlekseyPX3 years ago
8 0

Answer:

u want step by step?

Explanation:

You might be interested in
Are traits like athletic ability inherited or acquired?
liraira [26]
Partly genetic from body type, but most of it has to be acquired to be able to be good at athletic abilities  <span />
3 0
4 years ago
Explain boyles law pleaseeee helppp
mina [271]

Answer:

Explanation:

Boyle’s law is a gas law which states that the pressure exerted by a gas (of a given mass, kept at a constant temperature) is inversely proportional to the volume occupied by it. In other words, the pressure and volume of a gas are inversely proportional to each other as long as the temperature and the quantity of gas are kept constant. Boyle’s law was put forward by the Anglo-Irish chemist Robert Boyle in the year 1662.

7 0
3 years ago
Read 2 more answers
Question 6
alukav5142 [94]

The statement that provides evidence of the common ancestry of all life is near universality of the genetic code (option A).

<h3>What is the genetic code?</h3>

Genetic code is the set of rules by which the sequence of bases in DNA are translated into the amino acid sequence of proteins.

The genetic code has the following characteristics:

  • The genetic code is universal i.e all known living organisms use the same genetic code.
  • The genetic code is unambiguous i.e. each codon codes for just one amino acid (or start or stop)
  • The genetic code is redundant i.e. most amino acids are encoded by more than one codon.

Therefore, the statement that provides evidence of the common ancestry of all life is near universality of the genetic code.

Learn more about genetic code at: brainly.com/question/17306054

#SPJ1

4 0
2 years ago
Greg has been given a small sample of metal. His teacher has assigned him to identify what type of metal he was given.
lyudmila [28]
A ability to rust bc it just it
7 0
3 years ago
The organisms of which domain are organized according to their shape? A. Bacteria B. Archaea C. Eukaryota
-Dominant- [34]
The three domain system is develop by Carl Woese and is used to classify biological organisms. Under these would be bacteria,archaea and eukaryota. There are also kingdoms namely archaebacteria,fungi, plantae, etc.The answer on this question would be letter b. archaea
6 0
3 years ago
Other questions:
  • what happened during the cenozoic era? A. trilobites evolved B. modern birds evovled C. shellfish evovled D. dinosaurs dominated
    11·1 answer
  • Give an example of solute, solution, and solvent.
    9·2 answers
  • Anyone have the answer???????????
    14·2 answers
  • Only one human cell has a flagellum. this specialization allows the cell to propel itself forward. it is a ________.
    5·1 answer
  • Are marsupials mammals that lay eggs?
    10·1 answer
  • How are plant and animal cells similar?
    8·2 answers
  • How would an organisms homeostasis be affected if it was not able to produce enzymes
    8·1 answer
  • Term for Dominant vs Recessive
    11·1 answer
  • When new cells are formed through the process of mitosis the number of chromosomes in the new cell
    15·2 answers
  • Why are some shellfish (ocean animals, like oysters, that have shells) in danger of going extinct? None of the above. Fewer shar
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!