1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
11111nata11111 [884]
3 years ago
10

With a constellation as the background it would be easiest to detect the day to day motion of a

Biology
1 answer:
alina1380 [7]3 years ago
3 0
Constellation you are following.

Or if you are just seeing how the seasons change the constellations then you can see that too.
You might be interested in
The vatican archives maintain a vault where century's worth of old documents are stored in very high n2 levels to prevent oxidat
Vinil7 [7]

The Vatican archives stores multiple precious documents and books of the world. These old documents dating hundred of years are kept in high nitrogen levels, in order to prevent the oxidation of the paper (papyrus). The presence of the high level of inert nitrogen in the air in the archives prevents any kind of damage that may caused to the paper or the ink on those documents. This high level of nitrogen, however, may affect the health of the individual by decreasing the oxygen levels in the body.

Hence, the answer is 'the oxygen level will be decreased in the body'.

7 0
4 years ago
Food moves through the digestive tract by peristalsis, which is produced by wavelike contractions of ______ muscles answers
ozzi
Food moves through the digestive system tract by peristalsis, which is produced by wavelike contractions of INVOLUNTARY muscles
6 0
3 years ago
Read 2 more answers
What are possible negative effects of building a hydropower dam? Select the two correct answers.
MrMuchimi

The correct answers are B; Displacement of people living near the proposed dam and C; Lower river water levels in other areas.

Further Explanation:

The hydropower dam uses water instead of coal to generate electricity. Since they are build on the water, they will be using that source as a way to generate electricity. This will cause the water levels to be lower in some areas along the river.

When building a dam, they will need to use property that is located on the river. Many people own homes along the river banks all over the world. The company who will be building the dam will usually buy out the property owners at a fair market price. This will mean that they will have to move and leave their homes. The homes are typically torn down to make way for the dam.

In some instances, the water bills for the people in the area may be raised also since so much water is being used by the hydropower dam.

Learn more about a hydropower dam at brainly.com/question/5497101

#LearnwithBrainly

8 0
3 years ago
True or false the cerebral cortex is the highest portion of the brain?
pychu [463]
True
.................
4 0
3 years ago
Read 2 more answers
What did Mendel observed when he
Katarina [22]

Answer:

Green was dominant over yellow. So they were all green if you are talking about the first generation. The second generation would be a mix

Explanation:

8 0
3 years ago
Read 2 more answers
Other questions:
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Inside the cells of a leaf photosynthesis occurs. specifically, it takes place in the chloroplast of the leaf cell. when solar e
    6·1 answer
  • Had you been Louis Pasteur what would have been your reflections and conclusions based on this experiment?
    8·1 answer
  • Explain the importance of the Apollo missions.<br><br> Enter your answer in the space below
    7·1 answer
  • About how many cells are in an adult human body
    14·2 answers
  • Recovery from the 2008-2009 recession was agonizingly slow. what factors might have constrained faster growth?
    14·1 answer
  • Alleles are alternate versions of _____ gene(s) that have ____ nucleotide sequences. A. the same; completely different B. the sa
    14·2 answers
  • Which is true?
    9·1 answer
  • when two amino acids combine and the carboxyl group of the first amino acid reacts with the amino group of the second amino acid
    8·1 answer
  • PLEASE HELP:
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!