1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Margaret [11]
3 years ago
6

Question 10 of 10

Biology
2 answers:
meriva3 years ago
8 0

Answer:

c

Explanation:

i did it on apex and got it right

Sophie [7]3 years ago
7 0
What contains the different kind of molecules is the answer is D
You might be interested in
Which part of the neuron communicates an electrical signal to target tissue?
kirza4 [7]
The answer is- (c)Axon

3 0
4 years ago
What features do all cells have?
wariber [46]
All cells have a nucleus in the middle of it (Hope that helps)
6 0
3 years ago
Muscles work in _________________________________________, contracting and relaxing. These muscles are called __________________
7nadin3 [17]

Answer:

the human body first. 2 nd part joints

4 0
3 years ago
Please help! I will give you 20 points (brainiest if its right and helpful)
Sunny_sXe [5.5K]

Answer:I think you just said the answer keep them in the order you have it

Explanation:so you just put the colors under the different waves

6 0
3 years ago
Read 2 more answers
How do I identify controls, independent and dependent variables
frosja888 [35]

Answer:

what you change vs what you are testing

Explanation:

The independent variable is the variable that you change. For example, if we were growing plants and wanted to see if more sun made them grow higher, you would change the amount of sun that each plant is exposed to.

The dependent variable is what you measure. This depends on the independent variable. So, in our plant experiment, the height of the plant is the dependent variable.

Control. The control is what stays the same. So in our plant experiment, the amount of water, type of plant, type of soil, and all of these things would stay the same to insure that the results are equal.

You affect the independent variable and the control and you test the dependent variable.

5 0
4 years ago
Other questions:
  • Adenosine triphosphate is considered a high-energy compound. but how is that energy transferred to the cellular machinery?
    8·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Which of the following is a property of the stem of a dicot plant?Select one of the options below as your answer:A. ground tissu
    6·1 answer
  • According to the fossil record, which statement
    15·2 answers
  • 20. Many years 90, scientists working with cells developed what is now known as the
    9·1 answer
  • Abiotic Factors + Biotic Factors =
    11·1 answer
  • A cell has chloroplasts, numerous ribosomes, an endoplasmic reticulum, and a cell wall. What type of cell is this?
    7·1 answer
  • En la secuencia que muestra la producción de una proteína, se producen las moléculas ADN – ARNm -- ¿? – a.a., en el espacio dond
    9·1 answer
  • PLEASE HELP! BRAINLEIST FOR TEH BEST ANSWER AAC
    8·2 answers
  • Somatic cells can also be called
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!