Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.
Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT
These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
D NAD is used to directly break apart the glucose molecules I believe
At the end of transcription it's either DNA or RNA try googling it
The correct answer is C) the fluorescent cells can help track the movement of cells.
Explanation:
In the last years, geneticists and scientists created animals that glow in the dark by inserting a Green Fluorescent Protein or GFP gene found in some species of jellyfish. This protein was used in animals such as rabbits, rats, and even chickens. One of the key reasons for this is that by inserting fluorescence scientists can better observe the development and movement of cells. This includes analyzing cells reproduction and growing in embryos of "glowing" animals or inserting the protein in specific cells or organs in an organism to observe how these change or move. Thus, the purpose of studying fluorescent rabbits is that "the fluorescent cells can help track the movement of cells".
Answer:
sea sponge
Explanation:
everything else is symmetrical, sea sponges are known for being whacky shapes and sizes and are never symmetrical
