1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
UkoKoshka [18]
3 years ago
15

Help!!!! Me pls !!!!!!!

Biology
1 answer:
Darya [45]3 years ago
7 0

Answer:

C

Explanation:

the first 2 choices aren't even systems at all, and D is specifically talking about the water and not mentioning animals/plants at all.

hope this helps!

You might be interested in
What causes surface ocean currents to be deflected?
Nookie1986 [14]

Ok, so, to break it down for y'all:

A force, called The Coriolis Effect, causes the direction of winds and ocean currents to be

deflected!

In the Northern Hemisphere, wind and currents are deflected toward the right, while the Southern Hemisphere is deflected toward the left.

Glad I could help, byee XP

4 0
3 years ago
Read 2 more answers
HELP PLEASE. If coal production remained constant, coal consumption______
katovenus [111]

Answer: your answer is B.) stayed the same

Explanation:

plz mark brainliest

3 0
3 years ago
Read 2 more answers
In plants and animals, sexual reproduction causes variation
Yanka [14]
The answer is C, because if something contagious we’re to threaten the population of the species then not having any variant means they’re all the same and it would kill them all and cause them to go extinct
3 0
3 years ago
A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
AnnyKZ [126]

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

A pairs with T

G pairs with C

vise versa

3 0
3 years ago
Please help! WILL GIVE BRAINLIEST
Sati [7]

Answer:

The answer is 'Only D'

Explanation:

It says it is a recessive oattern of inheritance, so an individual needs to have both alleles for this disease (hh) in order to show it.

Hope this helped!!!

5 0
3 years ago
Read 2 more answers
Other questions:
  • and this experiment you will breed mice to investigate the role of genes when parents pass traits down to their offspring State
    5·1 answer
  • 1. Lynn is a 2-year-old girl. Her mom and she like to play a game where her mom pretends to
    13·1 answer
  • 2) Which term best describes energy transfer between trophic levels?
    12·2 answers
  • At the client's attorney, you have been provided with police videotape of the crime scene analysis. In the video, you notice tha
    7·1 answer
  • What amino acid is is coded for uaa on mrna wheel
    10·1 answer
  • Which mineral is never found freely in nature but is extracted from a chemical compound
    11·1 answer
  • What molecule contains the most energy ?
    6·1 answer
  • 5. What types of genes change very slowly?
    6·2 answers
  • Investigation Why are cells so small?
    7·1 answer
  • An unspecialized cell that has the ability to differentiate into a particular type of cell is called what?
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!