1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sashaice [31]
3 years ago
9

(don't answer) ran out of time on test lol

Biology
1 answer:
Bingel [31]3 years ago
8 0

Answer:

oof

Explanation:

You might be interested in
A simple apparatus used to show the process of osmosis is an​
zheka24 [161]
Osmosis provides the primary means by which water is transported into and out of cells. The turgor pressure of a cell is largely maintained by osmosis across the cell membrane between the cell interior and its relatively hypotonic environment.
3 0
3 years ago
9. Knowing what you know about how a substance travels in
Romashka-Z-Leto [24]

Answer:

Higher

Explanation:

Molecules such as oxygen move from a higher concentration to a lower concentration across a semi-permeable membrane. This process is called simple diffusion.

Therefore, for oxygen to leave the alveoli and enter the blood, there would need to be a higher concentration of oxygen inside the alveoli and a lower concentration of oxygen in the blood.

6 0
3 years ago
The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
liubo4ka [24]

The mRNA generated below was produced in the  <em><u>nucleus </u></em>of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

  • The synthesis of the mRNA s called transcription
  • The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.
  • It requires nucleotide triphosphates as substrates
  • catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

brainly.com/question/11430054

8 0
3 years ago
In the following image, which symbols (genotypes) are involved in the cross to produce the F2 generation of pink flowers?
Lesechka [4]

The dominant RR (red) and recessive rr (white). The color pink seems to be an intermediary between the dominant and recessive parent. Thus a heterozygote (Rr) that contains both a dominant and recessive gene will have a pink color.

3 0
3 years ago
Read 2 more answers
Compare and contrast baby suggs before and after sethe's arrival at 124
Ann [662]
<span>Initially, Baby Suggs was transformed into a kind of holy woman for the black community of Cincinatti. This was when she experienced freedom and realized the meaning of being alive. However, with Sethe's tragedy, Baby Suggs felt broken, and later on, spent her last days bed-ridden and in gloom. </span>
6 0
3 years ago
Other questions:
  • Why does sexual reproduction introduce variety or variation ina species in 3 ways
    11·1 answer
  • You are preparing an injection of a narcotic to relieve a pregnant woman's pain. as you are about to give it, she asks you for a
    8·1 answer
  • What is the function of a cell wall?
    12·1 answer
  • Which marine creature was thought to be extinct for 80 million years until one was caught off the coast of Madagascar in 1938?
    15·2 answers
  • Which condition can lead to neurogenic sock?
    9·2 answers
  • What happens when you mix vinegar and baking soda?
    12·2 answers
  • the movement of molten iron in earths core makes the planet act like a giant bar ______________, with one pole near the top of t
    11·1 answer
  • Cellular Respiration happens in the
    9·2 answers
  • Why do elements of the same group have the same chemical properties?
    6·1 answer
  • Which of the following materials would not normally be found in glomerular filtrate?
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!