1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
pshichka [43]
3 years ago
11

40 POINTS!!!! Please answer 16-22 and check my answers

Biology
1 answer:
Virty [35]3 years ago
4 0

Answer:

A kilogram (kg) is stated to be 2.2 times heavier than a pound (represented as lbs). Thus, one kilo of mass is equal to 2.26lbs

You might be interested in
Does facilitated diffusion use energy
alexandr402 [8]
Facilitated diffusion does not use cellular energy.

Since the transportation of molecules occurs through the concentration gradient, it doesn’t use cellular energy for transportation of molecules.
3 0
3 years ago
Which of the following is true about all minerals? A) Organic B) inorganic C) white D) hard
dsp73
The answer is A. Organic
5 0
3 years ago
Read 2 more answers
Deana is studying the karyotype of an unknown human donor. She observes that in each of the chromosome pairs, the two chromosome
Natasha2012 [34]

A) THE DONOR IS FEMALE

3 0
3 years ago
how would you use the scientific method to answer this question: do mice live longer when they are fed high-sugar diets
Zielflug [23.3K]

Answer:

The question: Do mice live longer when they are fed high sugar diets?

Hypothesis: There are two hypothesis the null hypothesis which we assume is correct, it states that a high sugar diet will have no effect on the life span of a mouse and an alternate hypothesis that we accept if evidence shows that sugar does increase the life span if mice. It says a high sugar diet does incerease the life span of mice.

Prediction: Assume that the null hypothesis is correct. High sugar diets will not increase the life span of the mice.

Collect data through experimentation. Use some mice as a 'control'. These mice will not undergo any changes but will be kept for comparison. Expose some other mice to high sugar diets and the compare the outcome with the 'control' mice.  

Analyzing: From the experiment this you can choose which hypothesis you are going to accept. I.e. null: no change or alternate: there was a change and do some extra research to back up your hypothesis.

Hope this helps :)

8 0
4 years ago
When an enzyme is functioning at vmax, the rate of the reaction is limited by?
mestny [16]
I guess because of concentration.....it stops !
5 0
4 years ago
Other questions:
  • What is cactus plant?
    13·2 answers
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • What is the domain containing all organisms with eukaryotic cells?
    6·1 answer
  • In a(n) _________________________________, one of the blood vessels in the brain ruptures or breaks open and blood enters the br
    15·1 answer
  • Of the statements below, identify the one that best describes the relationship between plants and oxygen.
    10·1 answer
  • HELP!!!!
    10·1 answer
  • Energy and matter cycle through a beach ecosystem on the Gulf of Mexico. Identify one kind of model you can use to show the path
    15·1 answer
  • How is the ruminant digestive system different than human digestive system?​
    10·2 answers
  • What is the basic scheme of the nervous system
    5·1 answer
  • All organisms and the natural cycles of the earth operate:
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!