1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vilka [71]
4 years ago
12

if the temperature of a liquid decreases because the particles move farther apart. what are the variables in this hypnosis?

Biology
1 answer:
Arada [10]4 years ago
7 0

Explanation:

Because the effective volume per unit mass ie (density) is decreased thus effective heat capacity decrease thus temperature of liquid decrease as the particles move further apart

You might be interested in
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Need help<br> Brainlist will be given
torisob [31]
1. Cayote’s population would go down because their source of prey has gone down because of poisoning.

2. Squirrels are omnivores, meaning they can still survive without eating meat because they also eat plants (nuts).
5 0
3 years ago
Targeting inflammation as an infection control mechanism is a double-edged sword. On one side, inflammation evolved to help elim
max2010maxim [7]

their will be increased vessel permeability.

4 0
4 years ago
What usually drives animal research is the benefit to human beings of that research?
svlad2 [7]

Answer:

i dont understand what do you mean. theres a spelling mistake

Explanation:

8 0
3 years ago
Read 2 more answers
Is bacteria in human intestines a commensalism mutualism parasitism or predator and prey relationship?
____ [38]
It's a mutualism relationship because both species can benefit from each other.
6 0
3 years ago
Other questions:
  • Which is not a result of the agricultural revolution?
    12·2 answers
  • Of the procedures to analyze data listed, which one is most likely to result in an inaccurate prediction?
    10·1 answer
  • How long can a human live without food
    14·2 answers
  • The image shows an ant that has been infected by a fungus, with the sporangium of the fungus emerging from the ant’s head. What
    9·1 answer
  • The great white shark carchardon carcharias belongs to what genus?
    14·2 answers
  • Which of the following is NOT part of genetic "linkage mapping"?
    11·1 answer
  • A person infected with the Ebola virus will experience symptoms within 2 to 21 days of being exposed to the virus. During this t
    8·1 answer
  • Cual es la funcion de la respiracion
    14·1 answer
  • Which of these is made by reading a short snippet of DNA, and then sent away right after?
    6·1 answer
  • Carbon forms the basis of all of the following compounds except___?
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!