1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Masteriza [31]
3 years ago
7

Japan is the leading producer of farm-raised shrimp, offering a lower price than Americans who farm or catch shrimp for a living

. Shrimp farming requires converting coastline estuaries into holding pens for the baby shrimp to grow in. What will be the long-term consequences for Japan if this industry continues to grow?
Biology
1 answer:
antoniya [11.8K]3 years ago
7 0
They will continue to diminish coastline and eventually coastline could disappear for japan
You might be interested in
As solar energy interacts with carbon dioxide, water vapor, and several other gases in the troposphere, it warms the troposphere
Veronika [31]

As solar energy interacts with carbon dioxide, water vapor, and several other gases in the troposphere, it warms the troposphere process known as the Green house effect.

  • Troposphere is the lower most part of the earth's atmosphere comprises of Nitrogen, Oxygen, Argon, Carbon dioxide and Water vapour.
  • Carbondioxide, water vapour and other gases like methane are concentrated highly in the Trophosphere due to some human activities (Industrial revolution).
  • Such excess Green house gases forms a shield layer which retains the heat by trapping the long wave radiation of solar energy in troposphere. As a result, global warming and abnormal weather conditions occurs in the planet.

Learn more about the Green house effect on brainly.com/question/21469833.

#SPJ4

5 0
1 year ago
Which of these cells of the dermal tissue of plants prevent water loss and control gas exchange?
irinina [24]

Answer:

Guard cells prevents this from happening

4 0
2 years ago
Read 2 more answers
3. During meiosis,
Anna71 [15]

Answer:

Cells divide twice

Explanation:

Meiosis may be defined as the process of cell division in which a single cell divides to give four daughter cells and each daughter cells  have half number of chromosomes.

Meiosis is also known as reduction division as the chromosome number reduces upto half in the progeny cells as compared with the parent cell. The cells divide twice in meiosis and give rise to four daughter cells.

Thus, the correct answer is option (4).  

3 0
3 years ago
Which component is missing from the process of cellular respiration?
liq [111]

Answer:Oxygen

Explanation: During cellular respiration, glucose is broken down in the presence of oxygen to form carbon dioxide, water and energy. Glucose + oxygen --> carbon dioxide + water + energy.

The balanced chemical equation for cellular respiration is C6H12O2 + 6O2 --> 6CO2+ 6H2O + Energy

3 0
3 years ago
Is glycerol a <br><br> A) lipid<br> B) protein<br> C) carbohydrate
Rama09 [41]

Answer:

a

Explanation:

a lipid is the right answer

4 0
2 years ago
Read 2 more answers
Other questions:
  • What is the layering of sediments in sedimentary rock called?
    10·2 answers
  • Which of the following includes only biotic factors?
    5·1 answer
  • Cranial nerve II, the optic nerve sends nerve impulses to the brain carrying information about the things we see. These nerve fi
    5·1 answer
  • A pesticide that kills an insect by interfering with the production of proteins in the insect would most directly affect the act
    5·1 answer
  • Can someone explain the 4th dimension to me the best you can?
    10·1 answer
  • What is the carbon cycle?
    15·1 answer
  • During what part of photosynthesis is O2 produced?
    12·1 answer
  • What is the phenotypic and genotypic ratio of a cross between 2<br> heterozygous green pea plants?
    14·1 answer
  • 1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
    13·1 answer
  • What are the functions and vessels of the heart, and what are some cardiac disorders that might be life-threatening to a person
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!