1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
pishuonlain [190]
3 years ago
11

Identify each adaptation as structural or behavioral adaptations.

Biology
2 answers:
Irina18 [472]3 years ago
6 0
Number one is structural and 2 is behavior
Three is structural
Four is structural
The last one behavior
Ronch [10]3 years ago
6 0

Answer

1.Monkeys have a prehensile tail that allows them to grab and hold onto tree branches…structural

2.Moose make mating calls to locate potential mates…behavioral

3.Whales are covered in a thick layer of blubber, insulating their bodies in cold ocean waters…structural

4.Humans have five toes on each foot to help them maintain balance…structural

5.Many birds migrate south for the winter in search of food…behavioral

Explanation

A structural adaptation is a physical feature of an organism as a result of the evolutionary process that occurs due to mutation of genes over time. For example, long furs that help to keep the temperature of an organism warm is a structural adaptation

Behavioral adaptations are the things organisms involve themselves with to ensure survival as a result of evolution. For example, the migration of birds to other places in search of food is a behavioral adaptation.




You might be interested in
Fungi and bacteria are considered
Oksana_A [137]

Answer:

infection

Explanation:

4 0
2 years ago
8. What factor contributes the most to the overall health and sustainability of an<br> ecosystem?
ad-work [718]
The higher biodiversity in an ecosystem means that there is a greater variety of genes and species in that ecosystem. A great variety of genes and species means that the ecosystem is better able to carry out natural processes in the face of external stress. Thus, the ecosystem is more sustainable.
7 0
3 years ago
Read 2 more answers
What occurs during a decomposition reaction? The components of several molecules recombine to form new molecules. A compound par
Volgvan
<span>During a decomposition reaction, a compund partitions into it's components. This is a type of a chemical reaction where a larger/more complex compund is broken down into simpler elements or compounds which were initially combined in a chemical reaction.This type of reaction often requires an energy source such as heat or light to break down the compound.</span>
4 0
3 years ago
Pick only ONE sentence Which sentence from the section shows why the right temperature is important for plants? (A) Temperature
Arisa [49]

Answer:

The correct answer is - (B) As with any living thing, a plant has an optimal temperature range at which it grows and performs best.

Explanation:

Like any other or most of the living organism, plants also required an optimal temperature range as they also required appropriate temperature for their growth and development and perform their functions at their best.

Optimum temperature range is a temperature range at which something performs its best similarly plants perform their cellular functions like photosynthesis, metabolism, reproduction, and many other functions that require a particular temperature range.

8 0
3 years ago
What is the cutest animal
nataly862011 [7]

Answer: A puppy

Explanation: it just is

5 0
3 years ago
Read 2 more answers
Other questions:
  • Which of the following is true about natural selection?
    9·1 answer
  • When the human body is responding to stress the hormone adrenaline is released a short time later the body returns to normal thi
    10·1 answer
  • A wave has a wavelength of 15 mm and a frequency of 6 hertz. What is its speed?
    5·1 answer
  • What are the ten biomes, and what appears to be the most prominent biome in North America, South America, Asia, Africa, Australi
    8·2 answers
  • Select the correct locations on the image identify the organ the produces sperm
    7·2 answers
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • Match the sphere with its correct statement.
    5·2 answers
  • I need the answer please
    15·1 answer
  • What is an advantage and disadvantage of OPEN ended questions?
    11·2 answers
  • Many viral diseases are combated by prevention through
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!