1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mestny [16]
3 years ago
5

What is a buffer? a solution that can receive any amount of acid or base to form a neutral solution a solution that neutralizes

bases and drops the pH of acids a solution that can receive moderate amounts of acid or base with little change in pH a solution that neutralizes acids and increases the pH of bases
Biology
1 answer:
Nutka1998 [239]3 years ago
4 0
An ionic compounds resist change in its pH
You might be interested in
How are conduction and indoction alike and how are they different
PolarNik [594]

Both conduction and induction involve a movement of electrons. Conduction is the transfer of electrons from a charged object to another object by direct contact. Induction does not involve direct contact. Instead, induction is the movement of electrons from one part of an object to another as a result of the electric field of the second object.  What is the difference between conductive and non-conductive?  Conductive materials are good conductors of heat or electricity. Nonconductive materials are not good conductors of heat or electricity. I hope this helps! :)

3 0
3 years ago
One of these in a biome would be the climate abiotic factor biotic factor Biome
bulgar [2K]

Answer:

yes it is yes it is abiotic factor

7 0
3 years ago
Read 2 more answers
Beginning in the mid 1600’s Earth entered into a mini-ice age
crimeas [40]
Beginning in the mid 1600's Earth entered into a mini-ice age. 1815 was known as the "year without a summer" and snow fell in many European countries during the summer months. The prolonged climate change is attributed to low sun spot activity, while the summer snow is believed to be the result of

A major volcanic eruption.
8 0
3 years ago
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
3 years ago
_____________ growth occurs when the growth rate is proportional to the size of the population.
Rudiy27
Exponential is the missing word
5 0
3 years ago
Read 2 more answers
Other questions:
  • When the temperature of the environment changes, what dose the body temperature of a reptile do
    7·1 answer
  • 3. Draw a circle on a flat surface. Look at it from the side. What do
    9·1 answer
  • Where would higher levels of potential evapotranspiration occur on an average?
    9·1 answer
  • the outermost layer of the skin is called the __________. a. epidermis b. dermis c. out layer d. proteins
    11·1 answer
  • Please help with this
    13·2 answers
  • Adaptive evolution is a permanent change in a trait.
    11·1 answer
  • Choose the best explanation of the difference between evolution and natural selection.
    11·1 answer
  • HELP ASAP PLEASE!!!!!!!!
    6·1 answer
  • Which term names part of the peripheral nerves system A spinal cord B brain C sensors​
    9·2 answers
  • What is the difference between a theory and a law?
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!