1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
IceJOKER [234]
3 years ago
9

Which of the following is NOT part of the water cycle?

Geography
2 answers:
Nadya [2.5K]3 years ago
8 0

Answer: Option (D)

Explanation: In the water cycle, water is transported from the oceans, seas and lakes to the atmosphere, which then again falls back due to precipitation.

       Plants also absorbs water by their roots and releases back into the atmosphere by evapo-transpiration process. Some of the water gets percolated into the ground and gets mixes up with the groundwater.

     Thus all the provided options fulfills the condition for water cycle except the last one, i.e dissolution of CO₂ in the ground water or the land surface is not considered to be a part of water cycle.

Hence the correct answer is option (D).

torisob [31]3 years ago
3 0

Answer:

The answer is D (Calcium carbonate dissolving in soil water and groundwater is not the part of water cycle)

Explanation:

There are 5 stages of water cycle:

  1. Evapotranspiration: In this stage water converts into gaseous form due to intense heat. when water evaporates from a water body it is termed as evaporation and when it evaporates from the soil, plants and other solid material like constructed material (walls, buildings) it is termed as transpiration. So, collectively we use the term evapotranspiration (Evaporation+Transpiration)
  2. Condensation: Water (in gaseous form) goes upward and condensed and it forms clouds. Or in other words, condensation is the process by which water vapor in the air is changed into liquid water. Condensation is crucial to the water cycle because it is responsible for the formation of clouds. ... Condensation is the opposite of evaporation.
  3. Precipitation: Due to condensation process gaseous water converts into water droplets and water released from clouds in the form of rain, freezing rain, sleet, snow, or hail. It is the primary connection in the water cycle that provides for the delivery of atmospheric water to the Earth.
  4. Surface Runoff: Rain water runs on surface of the earth and fall into rivers and streams. And finally it joins the ocean again in the form of stream/river flow. Runoff that occurs on surfaces before reaching a channel is also called overland flow.
  5. Infiltration: Sometimes water infiltrates/penetrates into surface ground and increase the underground water table and it also joins main underground water flow.  Or in other words, water soaks into subsurface soils and moves into rocks through cracks and pore spaces and finally joins main stream or river.

       So there is only D option that is not part of water cycle.

Learn more:

  1. Why is the water cycle important to life on earth? brainly.com/question/1535846
  2. What is the difference in between water cycle in the desert and water cycle in the rainforest?                                  brainly.com/question/8707416

Key words: water cycle, evapotranspiration, condensation, precipitation,     surface runoff, overland flow, infiltration

You might be interested in
Stone monument that includes the same passage carved in hieroglyphics, demotic script, and greek and that was used to decipher t
yuradex [85]

Answer:

The Rosetta Stone

Explanation:

You might have heard of this stone before. It is a popular language learning app but it also is an ancient stone that helped people to decipher ancient Egyptian hieroglyphics. It has a message in hieroglyphics and demotic script with a Greek translation on the bottom, so people were able to figure out what many of the hieroglyphs meant.

Have a wonderful day! :D

8 0
3 years ago
Read 2 more answers
Because of urban sprawl in the United States, an area the size of which state is paved over each year?
Valentin [98]

Answer:

. Delaware

Explanation:

Delaware, a small Mid-Atlantic U.S. state, sits on a peninsula marked by dune-

backed beaches bordering the Atlantic Ocean, Delaware River and Delaware Bay. In

Dover, the capital, First State Heritage Park encompasses 18th-century Colonial

landmarks like the Georgian-style Old State House. The city of Wilmington is known

for the Riverfront, a waterside district of parks, boutiques and restaurants.

8 0
2 years ago
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
What is the pattern of migration in UAE ?
Harman [31]
<span>Sep 18, 2013 - India, Bangladesh, and Pakistan are the top countries of origin of temporary labormigrants in the United Arab Emirates. ... Over the past few decades, the United Arab Emirates (UAE)—one of the world's pre-eminent oil-rich nations located in the Gulf Cooperation Council (GCC) region ...</span><span>
</span>
7 0
3 years ago
Which city has the largest population in the world?
Effectus [21]
Tokyo/Yokohama is city with the largest population in the world. It has over 33 million people.
7 0
3 years ago
Read 2 more answers
Other questions:
  • How many seismic stations are needed to locate the epicenter of an earthquake?
    14·1 answer
  • Why do foreign investors hesitate to invest in central america?
    10·1 answer
  • What is he difference between rivers and wetlands?
    13·1 answer
  • Which of the following are responsible for the formation of some of the world's highest mountains? A. tactile plate B. boundarie
    5·2 answers
  • Describe the contributions of the Khmer Empire to the culture of Southeast Asia.
    11·2 answers
  • why are many volcanoes and earthquakes in the same area? plzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz someone give me the answer!!!!!!!
    7·1 answer
  • Al Salaah is the second Pillar of Islam, it is the first thing we will be questioned about. If our Salaah is accepted, then all
    12·1 answer
  • How do the geographic features of Europe contribute to the differences in the<br> people?
    14·1 answer
  • if the atmosphere is unstable and has strong winds, then the emissions from a smoke stack will ____________.
    10·2 answers
  • Why are surface waves more destructive to buildings than the initial seismic wave in an earthquake?.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!