1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tino4ka555 [31]
3 years ago
12

UNTUU HULLUM

Biology
1 answer:
atroni [7]3 years ago
4 0

Answer:

UNTUU HULLUM

Overfishing occurs when more fish are removed from an ecosystem than can be maintained by the population,

Overfishing can lead to significant population declines in economically important species. The passage describes

additional impacts of overfishing on populations.

pressure affects

salmon fishery of

and 1970s, pink

n this fishery were

ihile allowing

nd 1974, the

inland spawning

approximately

to spawn at the

Isted that fishing

lower growth rates

According to the passage, which mechanism explains the observed changes in fish size over time?

A. Smaller fish produce fewer eggs than larger fish do, so they contribute fewer offspring to the next

generation.

B. Fish that are small enough to escape fishing nets are more likely to survive than larger fish.

C. Scientists found that Atlantic silversides exhibited changes in feeding and foraging rates after four

generations of selection,

D. The average size of pink salmon returning to spawn decreased from 6.0 pounds to approximately 4.5

pounds.

You might be interested in
how the skin cells, neurons, muscle cells, and blood cells you have observed relate to the functions of skin, nerve, muscle, and
serious [3.7K]

every cell has work to do but different cells may have different jobs in multicellular organisms, cell with the same type of job often work together. These group of specialized cell from tissue in turn, tissue often group together to form larger units called organs the heart is an organ; so is the stomach.

4 0
2 years ago
Which types of vessels will be the first to contact the blood from the ventricles
nlexa [21]

Answer:

Arteries are the vessels that will be the first to contact the blood from the ventricles. Arteries are blood vessel that transports blood from the heart to other parts of the body such as lungs and tissues.Explanation:

6 0
3 years ago
Read 2 more answers
A bat species (species 1) lives in a city. Another bat species (species 2) established a population in that same city after some
ddd [48]

Answer:

Roosting areas in buildings of any height are the resource partitioning of both bat species.

Explanation:

  • The <em>fundamental niche</em> refers <u>only </u>to <u>physic conditions</u> in which a species can live and survive in the absence of any interaction with other species.
  • The <em>realized niche</em> refers to the <u>restricted conditions</u> in which a species can live and survive as a result of <u>environment physic characteristics</u> and the <u>interaction</u> with other species.
  • <em>Competitive exclusion</em> refers to the <u>exclusion</u> of the inferior competitor by the superior competitor when there is not habitat differentiation, and both species can not share the same niche. In this case, the effective niche of the dominant species completely occupies the fundamental niche of the inferior competitor.
  • Resources partitioning refers to one dominant species monopolizing the resources, and the other inferior species use resources -partially or completely-, migrates or get extinguished.

A way in which species can divide resources is by living in different habitat areas. These species <em>might eat the same food</em>, and <em>can roost in different places</em> within the same habitat. This resource partitioning and differentiation in the function of their physic location allows both species to coexist more effectively.

In the present example, both bat species can coexist in the same city but the weaker bat species (species 1) roost at the top of the shorter buildings while dominant species (species 2) roost at the top of the highest buildings.

5 0
2 years ago
Compare the physical and chemical properties of a compound to those of the elements of which it is composed.
yuradex [85]

Explanation:

Compounds are those substances that are made up of elements that are combined in a fixed proportion or ratio. The individual property of element is lost once it forms a compound. The physical and chemical properties of both compound and an element is different.

Example of a compound is water and its elements are hydrogen and oxygen. Water is a colorless liquid that acts as a solvent and dissolves most of the solutes in it. While oxygen and hydrogen occurs as gases in their elemental state.

5 0
2 years ago
Read 2 more answers
Sister chromatids separate (and are now called chromosomes) and begin to move toward the poles of the cell. This happens in
NeX [460]

Answer:

sister chromatids separate and begin to move towards the pole of the cell during anaphase.

6 0
3 years ago
Other questions:
  • Which of the following is NOT true about “yield”? a. the value of the actual yield must be given in order for the percent yield
    14·1 answer
  • The process of copying a gene's dna sequence into a sequence of rna is called what?
    7·2 answers
  • On what continent did the earthquake occur?
    9·1 answer
  • Please answer these questions.
    7·1 answer
  • Which statements explain reasons why unconformities occur? Check all that apply.
    11·2 answers
  • Explain 2 differences between the daughter cells made during meiosis compared to mitosis.
    15·1 answer
  • By what process do streams and rivers move material?
    12·1 answer
  • B) Describe the characteristic of DNA that determines which protein is formed.
    14·1 answer
  • Which month receives the most precipitation in Alexandria?
    14·2 answers
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!