1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
JulsSmile [24]
3 years ago
12

There is antibody-mediated and cell-mediated specific immunity. Which type of cells are primarily involved in the antibody-media

ted immune response?
A. Macrophages
B. B cells
C. Complement proteins
D. T cells
E. Antigens
Biology
1 answer:
amid [387]3 years ago
5 0

Answer:

The correct answer is option B. B cells.

Explanation:

An antibody-mediated immune response is an immune response that involves the B cells to recognize the antigen or pathogen present in the blood or the lymph of an individual that is the reason it is also known as the humoral immune response.

The primary response in the antibody-mediated response is B cells as they are activated by the chemicals released by the helper T cells and start producing plasma B cells and memory B cells.

Thus, the correct answer is option - b. B cells.

You might be interested in
How many genes for a trait are present in a human sex cell?
zavuch27 [327]
Each "human body cell" has 46 chromosomes. But human sex cells have 23 unpaired chromosomes in each cell. Sex cells are created by a special type of cell division, Meiosis.
5 0
3 years ago
Read 2 more answers
On Earth, Dallas weighs 120 N and has a mass of 16,4 kg. If Dallas travels to a planet where gravity is just half of that on
Alika [10]
The best answer to go with is b
5 0
3 years ago
Two species of lizards we will call them A and B
torisob [31]
Sorry, what's the question?
7 0
3 years ago
The graph shows that the world’s coal reserves are
blondinia [14]
Going down because of the new technology is this age
7 0
3 years ago
What is the role of primase is the process of bacterial dna replication? g?
DiKsa [7]
<span>Primase is the enzyme that synthesizes small fragments of RNA in the strand lagging in DNA replication. The primase does not need a primer to synthesize and the RNA residues are removed by DNA polymerase I, due to their exonuclease capacity and filled with DNA fragments also by DNA Pol I. Finally, all these discontinuous DNA segments are linked by a ligase.</span>
8 0
3 years ago
Other questions:
  • Do you think humans should try to set up a colony on Mars? Why or why not?
    14·1 answer
  • The energy of wavelengths that appear ______ is least useful to photosynthesis.
    12·2 answers
  • What kind of contraception can a person with breast cancer use?
    14·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Help with earth science?
    6·1 answer
  • Three nucleotide bases in mRNA, that specifies (codes for) a particular amino acid is called a(n)
    11·1 answer
  • 100 points and Brainliest!!! Plus, an opportunity for an extra 100 points if correct.
    6·1 answer
  • In reference to pedigree charts, a woman who expresses a specific trait would be represented by a __. *
    14·1 answer
  • Based on this diagram, do you think that organisms of the same order will share a stronger evolutionary
    12·1 answer
  • Apa template about multiple sclerosis
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!