1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alina [70]
3 years ago
5

Earth makes one revolution every _____. A. 12 hours B. 24 hours C. 6 months D. 365 days

Biology
1 answer:
cluponka [151]3 years ago
7 0

Answer:

D. 365 days

Explanation:

Revolution means covering distance and moving around the sun so it takes a year or 365 days revoluting around the sun.

You might be interested in
Place the steps involved in the process of bacterial transformation in the correct order.
MariettaO [177]

Answer:

E-A-B-C-D

Explanation:

The steps involved in the process of bacterial transformation in the correct order are;

E. Donor cell lyses, releasing pieces of its chromosome into the environment.

A. Donor cell DNA binds to a receptor site on the recipient cell.

B. One strand of the donor cell DNA is degraded.

C. Transformed DNA pairs with homologous region on the recipient cell chromosome.

D. Transformed DNA recombines with the recipient cell chromosome.

3 0
3 years ago
Read 2 more answers
11- Trigliseritlerle ilgili aşağıdaki ifadelerden hangisi
Vlada [557]

Answer:

cevap c 1 gliserol bulunur 2tane yag bulunur .

7 0
3 years ago
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
1. ¿Crees que hay algún elemento de tu cuerpo que no cambie durante toda tu vida? O, todo cambia
VMariaS [17]

Answer:

si todo cambia porsue le encanta el cambio

4 0
3 years ago
Summarize the water cycle
Dafna11 [192]

Answer:

<em><u>The water cycle describes how water evaporates from the surface of the earth, rises into the atmosphere, cools and condenses into rain or snow in clouds, and falls again to the surface as precipitation. ... The cycling of water in and out of the atmosphere is a significant aspect of the weather patterns on Earth.</u></em>

7 0
3 years ago
Other questions:
  • Why do you think that most predators (humans, cheetahs, dogs, etc.) have eyes facing forward, while most prey species (cows, dee
    14·2 answers
  • Which pair of organisms is most closely related to primates? amphibians and rodents ,crocodiles and amphibians ,rodents and rabb
    9·2 answers
  • How many years does an apple tree live useful?
    6·1 answer
  • ________ is composed of multiple globular molecules polymerized to form long chains or filaments.
    10·1 answer
  • The. Are connective tissues dominated by lymphocytes?
    11·1 answer
  • Any groups of organisms that look alike and can reproduce among them are known as?
    8·1 answer
  • What is the purpose of protein synthesis?
    12·1 answer
  • Water absorbed by the roots moves through the stem and enters the leaves. Most of this water is lost in transpiration. Explain h
    7·1 answer
  • What are the cons of purchasing a home? A. Buyers are typically required to buy homeowner's insurance. B. Home owners have to pa
    7·1 answer
  • Hello people ~
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!