1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ira [324]
3 years ago
8

Which organelle houses the genetic material DNA?

Biology
2 answers:
Evgesh-ka [11]3 years ago
8 0

Answer:

Image result for Which organelle houses the genetic material DNA?

nucleus

The nucleus is a membrane-enclosed organelle, found in most eukaryotic cells, which stores the genetic material (DNA).

Explanation:

s2008m [1.1K]3 years ago
5 0

Answer:

The nucleus

Explanation:

its the organelle that stores genetic materials such as DNA

You might be interested in
List the distribution of earths water from the greatest amount to the least amount
GuDViN [60]

Answer:

The distribution of water on the Earth's surface is extremely uneven. Only 3% of water on the surface is fresh; the remaining 97% resides in the ocean. Of freshwater, 69% resides in glaciers, 30% underground, and less than 1% is located in lakes, rivers, and swamps.

Explanation:

4 0
3 years ago
Tip or up vote true or false Evolution is accepted by most scientists as a fact of nature.
stira [4]
This answer
 would be true
3 0
3 years ago
Michael, 25 years old, has had mitral valve regurgitation since age four, after having rheumatic fever. michael is planning to g
Juli2301 [7.4K]

The answer is penicillin

Rheumatic fever is a disease that caused by Group A streptococcus infection. The bacteria has component that similar to the heart valve cells, makes the immune cell attack it. The drug of choice for this infection is penicillin G benzathine injection. It is one of penicillin family drug that has high prevalence of allergy reaction, so you must be aware.

5 0
3 years ago
In order to prevent or detect cervical cancer early, all girls and women should have _______ three years after they begin having
bekas [8.4K]
In order to prevent/detect cervical cancer early, all girls/women should have a pap smear (or the fancy name of Papanicolau smear) every 3 years after they begin having intercourse or at the age of 21, regardless of sexual activity.
5 0
3 years ago
List the 4️⃣stages of mitosis. *
jekas [21]

Answer:

Prophase

Metaphase

Anaphase

Telophase

Explanation:

Use the slugon PMAT

3 0
2 years ago
Other questions:
  • In which step of translation does the tRNA become charged? a.initiation b.activation c.elongation
    11·1 answer
  • Chemical reaction equations, such as the one for photosynthesis, show the reactants and products of a reaction. How does this si
    7·2 answers
  • What type of cell transport uses carrier proteins? A. Passive diffusion B. Osmosis C. Active transport D. Facilitated diffusion
    9·2 answers
  • Please help me ASAP I’m kinda irritated lol
    8·1 answer
  • In his work on the two-point threshold, Weber found that the most sensitive area (smallest threshold) was the ____ and the least
    14·1 answer
  • What was the purpose of the field study? keys and kingdoms worksheet
    12·1 answer
  • 1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
    13·1 answer
  • Five significance of genetic engineer​
    12·1 answer
  • If a particular cell is known to be round and incapable of producing its own food, which one of these organelles would you assum
    8·1 answer
  • What is the name of the tiny air sacs in your lungs?
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!