Both "depends upon the binding of that substance to a specific site on the membrane protein" and "depends upon movement of proteins from one side of the membrane to the other" are correct.
The saturation effect prevents statement 2 from being true.
The herbivore eats plant and the carnivore it’s meat each one eats one specific thing meaning that on a food feb as long as they keep doing what they are doing it doesn’t mess the environment around them
If a bacterium uses ammonia as an energy as well as electron source, it is classified as lithotrophic chemotrophic.
<h3>Descriptive terms for lithotrophic
chemotrophic:</h3>
Humans, fungi, and also many prokaryotes are chemotrophs that get their energy from organic chemicals. Lithotrophs are chemotrophs that obtain energy from inorganic substances such as hydrogen sulfide (H2S) as well as reduced iron. Lithography is a microbiological phenomenon that is unique in the globe.
<h3>What is the difference between chemoautotrophs and chemolithotrophs?</h3>
Chemotrophs are creatures that get energy from their surroundings by oxidizing electron sources. These compounds might well be organic (chemoorganotrophs) or inorganic (chemoorganotrophs) (chemolithotrophs). The term chemotroph is used in contrast to phototroph, which uses solar energy.
To know more about chemotrophic visit:
brainly.com/question/765577
#SPJ4
Answer:
d. T
Explanation:
For a given DNA sequence, the array is represented as:
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.
i.e.
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
*AGTGTCCAGG
Thus, the first nucleotide that will be incorporated into the DNA will be T
The most likely way is that it is from the mantle and got pushed up to the air and cooled down into a rock
