1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elza [17]
3 years ago
9

The main part of a virus are

Biology
1 answer:
kondaur [170]3 years ago
8 0

\text{Hey there!}

\text{The main parts of a virus are}

\mathsf{The\ main\ parts\ are\downarrow}\\\\\mathsf{The\ first\ one\ is\ the\ chromosome\  genomic\ DNA.}\\\mathsf{The\ second\ one\ is\ the\ protein\ capsid\ that\ covers\ most\ of\ the\ genome}\\\\\mathsf{They\ call\ it\ together \ a\ \underline{NUCLEOSCAPSID}}

\text{Good luck on your assignment and enjoy your day!}

~\dfrac{\frak{LoveYourselfFirst}}{:)}

You might be interested in
Enzymes antibodies and clotting compounds are made of
lys-0071 [83]
<span>Enzymes antibodies and clotting compounds are made of proteins, in which these proteins generally exist in different forms and a common example of it are the amino acids. To add up, these enzyme antibodies aids the immune system by serving as a catalytic antibody producing a hapten molecule.</span>
8 0
4 years ago
Hey can anyone pls write the conclusion for this !!!
Andrei [34K]

Answer: Don't know sorry

Explanation:

6 0
3 years ago
A cell needs to produce a large amount of protein. Which organelle would it be most likely to have many of?
Andrews [41]

Answer:

Eukaryotic cells

Explanation:

3 0
3 years ago
BRAINLIEST AND 100 POINTS FIRST ANSWER GETS BRAINLIEST!!!
nexus9112 [7]

Answer:

Half-Life is the time for a substance (U-235 in this case) to decay to 1/2 its original mass.

Since the problem is asking for the time for U-235 to decay to 1/2 its original mass (100 grams to 50 grams) then the decay time is 1 half-life, or 700 million years.

hope it helps u kindly mark as brainliest...

7 0
3 years ago
Read 2 more answers
Are lipids a type of fat?
Step2247 [10]
It comprises a group of naturally occurring molecules that include fats<span>, waxes, sterols, </span>fat<span>-soluble vitamins (such as vitamins A, D, E, and K), monoglycerides, diglycerides, triglycerides, phospholipids, and others. ... The word </span>lipid<span> stems etymologically from the Greek lipos (</span>fat<span>).</span>
5 0
3 years ago
Read 2 more answers
Other questions:
  • Why are microdeletions and microinsertions difficult to diagnosis using karyotyping?
    13·2 answers
  • What is<br>Chloroplasts<br>cell membrane<br>cell Wall​
    13·2 answers
  • People began measuring intelligence through tests roughly __________ years ago.
    5·1 answer
  • What name is given to the rigid structure, found outside the plasma membrane, that surrounds and supports the bacterial cell?
    8·1 answer
  • Hi guys does anyone have notes for lesson characteristics and classification of living organisms? Also I need some questions so
    12·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • The statements below compare the similarities of ultraviolet light and microwaves.
    13·1 answer
  • How can the location of a fossil reveal its age? Explain your answers
    9·2 answers
  • Starch and ATP can both be described as molecules that store energy. How do starch and ATP store and supply energy?
    11·2 answers
  • PLEASE HELP ASAP
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!