1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
melamori03 [73]
3 years ago
7

What happens to an enzymes structure as it exceeds the typical human bady temperature

Biology
1 answer:
Ivanshal [37]3 years ago
3 0
If an enzyme exceeds its optimum temperature, the molecules withing its primary structure vibrate so much that the shape of the site changes and becomes denatured.<span />
You might be interested in
4. What properties do compounds have with strong attractive forces between their atoms?
____ [38]
Because in simple molecules the intermolecular forces are a Coavlent bond and is formed between carbon and ionic compounds
3 0
3 years ago
According to the pie chart, which cause results in the most extinctions?
Sophie [7]
<h3><u>Answer;</u></h3>

B.introduced species

<h3><u>Explanation;</u></h3>
  • <em><u>Animals become extinct for a number of reasons. Currently many animals are endangered or have become extinct due to human activities or human influence.</u></em>
  • Extinctions may be caused by reasons;<em><u> such as pollution; loss of habitat due to human activities such as agriculture, introduced species, hunting and poaching for meat and other animal products such as feathers, horns and skins, and also over-harvesting among other influences.</u></em>
  • In this question; <em><u>Introduced species occupies the largest percentage, that is 39%, from the pie chart (Attached).</u></em>
  • Hunting and poaching; 23 %, Habitat loss; 26%, and Others; 2%.

8 0
3 years ago
Read 2 more answers
A plant makes glucose during photosynthesis. Glucose consists of the elements carbon, hydrogen, and oxygen. What is the source o
podryga [215]

Answer:

Glucose is produced by plants through photosynthesis. In this process, the plant uses light energy from the Sun to convert carbon dioxide and water into glucose and oxygen. Algae and certain bacteria and other unicellular organisms also produce glucose through photosynthesis.

Explanation:

5 0
3 years ago
What happen to the brain and the brain cavity?
Gnoma [55]

Answer: OK so The ventricles of the brain are a communicating network of cavities filled with cerebrospinal fluid (CSF) and located within the brain parenchyma. The ventricular system is composed of 2 lateral ventricles, the third ventricle, the cerebral aqueduct, and the fourth ventricle (see the images below).Survival in untreated hydrocephalus is poor. Approximately, 50% of the affected patients die before three years of age and approximately 80% die before reaching adulthood. Treatment markedly improves the outcome for hydrocephalus not associated with tumors, with 89% and 95% survival in two case studies

<h2>hope this helps have a awesome night/day❤️✨</h2>

Explanation:

8 0
3 years ago
Which of the following authors were known for their critical writing about the excesses and problems resulting from industrializ
Delvig [45]
The two authors who were known for their critical writing about the excesses and problems resulting from industrialization were Wingspanens and Mark Twain. Charles Wingspanens is better known by the name Charles Dickens. The correct answer is C. 
6 0
3 years ago
Other questions:
  • Explain what distinguishes primary and secondary consumers.
    14·1 answer
  • If future editions of the dsm change to a dimensional approach in the diagnosis of personality disorders, clinicians will have t
    8·1 answer
  • What do plants use for structural support and which macromolecule is it?
    9·1 answer
  • Changes in a single gene are called what
    13·2 answers
  • A method for treating hyperthyroidism is to administer sufficient amounts of radioactive iodine to destroy the thyroid secretory
    7·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Name 3 Native American groups who sided with the French
    12·1 answer
  • The spring garden smelled like
    13·2 answers
  • If the acceleration in question 8 is constant, what's the average velocity of the object described?
    8·1 answer
  • Can someone please help me??? Smart in science?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!