1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Papessa [141]
3 years ago
8

What is true of an atom’s nucleus?

Biology
2 answers:
bearhunter [10]3 years ago
8 0
It is made up of protons and neutrons
Marina86 [1]3 years ago
5 0

It is positivly charged and includes most of the atoms mass

You might be interested in
Within a species, a number of characteristics remain the same from one generation to the next. This is because ____________.
erik [133]
I think your answer would be D.
3 0
2 years ago
Differentiate between dominant and recessive traits
Diano4ka-milaya [45]
Dominant trait<span> definition. In genetics, a </span>trait<span> that will appear in the offspring if one of the parents contributes it. (Compare recessive </span>trait.) Note: In humans, dark hair is a dominant trait; if one parent contributes a gene for dark hair and the other contributes a gene for light hair, the child will have dark hair ...Recessive traits<span> can be carried in a person's genes without appearing in that person. For example, a dark-haired person may have one gene for dark hair, which is a dominant </span>trait<span>, and one gene for light hair, which is </span>recessive<span>.
</span>

5 0
3 years ago
Read 2 more answers
Name 3 critical areas of the body that are accurately maintained by homeostasis.
tester [92]

Answer: Respiratory system, Excretory system, and Endocrine system.

Explanation:

Homeostasis is the process through which several organ systems work to maintain a stable internal environment in the body. There are three organs of the body which ar eaccurately maintained by homeostasis:

Respiratory system: High carbon dioxide content in the blood triggers faster breathing. Most frequently, the lungs exhale, which quicker extracts carbon dioxide from the body.  

Endocrine system: High blood sugar content causes insulin release by an endocrine gland called pancreas. Insulin is a hormone which helps the cells absorb blood sugar.

Excretory system: A low blood level of water causes kidney accumulation of water. The kidneys contain more concentrated urine, so less water from the body is lost.  

Hence, three critical areas are respiratory system, excretory system, and endocrine system that are accurately maintained by homeostasis.

6 0
3 years ago
Which unit of measurement is used to record the volume of 10 sunflower seeds?
Pavlova-9 [17]

Answer:

centimeters

Explanation:

i would really appreciete brainliest

7 0
2 years ago
In an ecosystem, primary consumers eat plants. Secondary consumers eat
iogann1982 [59]
Hi dhhfbfuxjzkzozkzmz
8 0
2 years ago
Read 2 more answers
Other questions:
  • Any help?? Thank you!!
    12·1 answer
  • Children who have higher bmis, hypertension, and glucose intolerance have
    13·1 answer
  • (7th Grade Science)
    11·2 answers
  • What is a Dihybrid cross?
    9·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • How are rainbows made?​
    14·1 answer
  • Please can someone help I’ll do anything:(
    5·1 answer
  • Which process is more important; mitosis or meiosis
    7·1 answer
  • What part of a cell contains the information that an animal cell uses for growth and activities.
    11·2 answers
  • Someone please help me out with this.!
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!