1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
9966 [12]
3 years ago
8

The shape of a protein is primarily determined by

Biology
1 answer:
bulgar [2K]3 years ago
7 0


The best answer is A.

The shape of a protein is determined by its primary structure. The primary structure is the sequence of amino acids  in each polypeptide chain which make up a protein.

The sequence of amino acids is basically a list of amino acids that are linked to each other to form a chain which is known as a polypeptide chain.

The structure of the finished protein will depend largely on the first  (primary) chain of amino acids to be produced to make up that protein.

 

You might be interested in
What do u mean by traditional language ​
laila [671]

Answer:

Language spoken only in that country or place

5 0
2 years ago
A serve flood brings a lot of sediment and silt into the black river. The oxygen of the river decreases greatly. What is the r l
Tom [10]

Answer:

oxygen

Explanation:

A limiting factor is any condition whose decrease, increase, absence or presence is able to limit/stop population growth. Examples of limiting factors include abiotic conditions (e.g., temperature, water, oxygen, CO2, etc) or biotic conditions (e.g., food, mate, etc). There are many aquatic species that require high levels of oxygen (e.g., fish), thus being it a limiting factor for these species.

7 0
3 years ago
According to the Constitution of the United Mexican States (Mexico), which of these statements is FALSE?<br />
Jlenok [28]
I believe the answer is D
6 0
3 years ago
Using the graphs below, which group of moths is better adapted to survive the hunting cycle?
Mrac [35]

Answer:

Using the graphs below, which group of moths is better adapted to survive the hunting cycle?

Light moths on light trees

Explanation:

3 0
2 years ago
Read 2 more answers
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
Other questions:
  • Martha has been diagnosed as having vaginismus. besides intercourse, in what other scenario would martha experience the difficul
    6·1 answer
  • What are the 4 basic steps for DNA extraction?
    9·1 answer
  • How many primary tectonic plates make up the surface of Earth? -nine -eleven -seven -thirteen
    6·1 answer
  • When a plant produces sugars and transports them during translocation, which main plant tissues are at work?
    9·2 answers
  • which three types of cells are part of ground tissue storing food conducting photosynthesis and provinding support
    15·1 answer
  • What is the importance of hierarchy in classification ??
    9·1 answer
  • Which element is not found on most main sequence stars?
    15·1 answer
  • Help please I will mark brianlisy
    13·2 answers
  • Which two traits of some mammals are adaptations for living in a very cold,
    6·2 answers
  • A muscle cell with high concentration of carbon dioxide and a low concentration of oxygen is surrounded by blood with a high con
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!