1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Murljashka [212]
3 years ago
15

A doctor who specializes in diagnosing and treating diseases and disorders of the eyes and vision.

Biology
1 answer:
romanna [79]3 years ago
4 0
Optometrist or Ophthalmologist



You might be interested in
The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
liubo4ka [24]

The mRNA generated below was produced in the  <em><u>nucleus </u></em>of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

  • The synthesis of the mRNA s called transcription
  • The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.
  • It requires nucleotide triphosphates as substrates
  • catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

brainly.com/question/11430054

8 0
3 years ago
Does the law of reflection hold true for mirrors that aren’t flat ?
aniked [119]
YES!! At each point on the mirror, imagine that there is a very small flat piece of mirror that is tanger to the surface there. I hope this work for you:)
6 0
3 years ago
The sun's chemical energy is most useful to humans after it is converted to what?
ValentinkaMS [17]
The process by which plants capture energy from the sun and store it in the chemical bonds of sugars and other food molecules they make.
7 0
3 years ago
Which of the following is true of hydrogen bonds
Schach [20]
B. Hydrogen bonds make the positive sides of water molecules stick to each other
6 0
3 years ago
The marine multicellular protists including the larger brown algae belong to the
Finger [1]

Options for the question have not been given. They are as follows:

A. dinoflagellates.

B. Choanoflagellida.

C. Stramenopiles.

D. euglenoids.

E. foraminifera.

Answer:

C. Stramenopiles

Explanation:

Stramenopiles or heterokonts are a part of Chromista kingdom. They comprise of both unicellular and multicellular protists. They are characterized by presence of two dissimilar flagella in the motile life cycle stage. Their chloroplast is also surrounded by four membranes which indicates origin from symbiotic relationship. They include many classes like diatoms, golden algae and brown algae. Brown algae belongs to the class Phaeophyceae. They are marine multicellular algae and are commonly known as seaweeds.

6 0
3 years ago
Other questions:
  • Biochemistry is the study of
    11·1 answer
  • A lab assistant needs an organic compound. Would water work?
    11·1 answer
  • How many genes make up the human genome
    15·2 answers
  • In mammalian eggs, the receptors for sperm are found in the A) fertilization membrane. B) zona pellucida. C) cytosol of the egg.
    11·1 answer
  • HELP. Asap! Answer question in photo
    10·1 answer
  • What is the relationship between DNA, codons, and proteins?
    6·1 answer
  • What does the Miller-Urey experiment tell us about the origin of life?
    11·1 answer
  • The four parts of a seed include all of the following, except _____.
    7·1 answer
  • Which macronutrient provides 9 kilocalories per gram?.
    5·1 answer
  • Chlorophyll is found in the thylakoid which are found in chloroplast
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!