1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
noname [10]
3 years ago
13

Rational design requires:

Biology
2 answers:
Thepotemich [5.8K]3 years ago
5 0

Answer:

its a or d

Explanation:

pick one

spayn [35]3 years ago
3 0
It’s D. !!!!!!!!!!!!!!!!
You might be interested in
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
A red flowered pea crossed with a white flowered pea produces all red flowered offspring. If two of the F1 pea plants were cross
MrRissso [65]

Answer:2 red

Explanation:

4 0
3 years ago
Multiple choice just double checking the answer would be D Correct?
Paladinen [302]

Explanation:

John Dalton proposed the theory of matter which is popularly known as the Dalton's atomic theory. In the atomic theory, Dalton identified from his experiments on gases that every matter is made up of small indivisible particles called atoms. These atoms are the smallest fractions of a matter.

  • All the atoms of an element are all alike.
  • Compounds form from atoms by simple whole number combinations alone.
  • Chemical combination of atoms involves the rearrangement of reactants.

Therefore, using these clues you should be able to answer the question.

Learn more:

Dalton atomic theory brainly.com/question/1979129

#learnwithBrainly

7 0
3 years ago
Anybody that knows about blood types and transfusions please message me
Paha777 [63]

Answer:

I don't so so so so so sorry

Explanation:

Srry

3 0
3 years ago
Why do cells break down sugars
marin [14]
<span>To get energy. Sugars are particularly important fuel molecules. They are oxidized in the food we eat and must be broken down into smaller molecules before our cells can use them

</span>
8 0
3 years ago
Read 2 more answers
Other questions:
  • Which of the following cells would not have a well–defined nucleus but would have a thick cell wall and ribosomes?
    11·1 answer
  • What causes air masses to move?
    11·2 answers
  • Drugs deemed to have the highest potential for abuse and having a current medical use are listed in which schedule of the Contro
    14·1 answer
  • You obtained sequences of several long dna fragments with no sequence similarity to any known genomes. which sequence is the mos
    7·1 answer
  • Is Mars made of mostly gas or rocks
    11·2 answers
  • Cathy hypothesized that corn would not grow in mud. To test this hypothesis, she took corn kernels and placed 5 in mud, 3 in soi
    11·1 answer
  • How much of
    5·1 answer
  • What is the difference between transcription and translation? ​
    5·1 answer
  • PLEASE SOMEONE HELP MEEE
    11·1 answer
  • Describe methods of replication and protein synthesis in bacteria and viruses.
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!