1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Blizzard [7]
3 years ago
15

State the purpose of making urine.

Biology
2 answers:
quester [9]3 years ago
4 0
To get rid of the fluids that your body really doesn't need.
olasank [31]3 years ago
3 0
To get rid of excess fluids, and tell you whether or not you need to drink more fluids.
You might be interested in
play many roles in the body and determine many traits. In humans, is responsible for traits. Is the blueprint for proteins. The
morpeh [17]

-DNA is the blueprint for proteins, which play many roles in the body. PROTEINS play many roles in the body and determine many traits. The section of DNA that codes for a specific trait is called a GENE. In fruit flies, straight wings are dominant and curly wings are recessive.


5 0
3 years ago
Read 2 more answers
A 3-year-old male is brought to the emergency room with hypoglycemia following a brief seizure. His parents put him to bed the n
tresset_1 [31]

Answer:

Insulin > Glucagon.

Explanation:

The blood glucose level in the body is maintained by the two hormones known as insulin and glucagon. These hormones are released by the beta cells and alpha cells of the pancreas.

The insulin decreases the blood glucose level whereas glucagon increase the blood glucose level. The individual is hypoglycemic means that he has low blood glucose level in his body. At this condition, the body has high insulin and low glucagon level in the body.

Thus, the answer is Insulin > Glucagon.

6 0
3 years ago
Read 2 more answers
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
Do some organisms outcompete eachother
Helen [10]

Yes, Organisms compete for the resources they need to survive like food, air, water, space. In areas where these are sufficient, organisms live in comfortable co-existence, and in areas where resources are abundant, the ecosystem boasts high species richness (diversity).

4 0
3 years ago
Read 2 more answers
Which structure is found mainly in green plants in bacteria?
Anon25 [30]
The answer is Cell wall.
5 0
3 years ago
Read 2 more answers
Other questions:
  • The flat structure of a leaf blade enables its function as a photosynthetic organ by
    10·2 answers
  • List five observations Darwin made about the Amblyrhynchus lizards.
    15·1 answer
  • The organic compounds that are used for long-term energy storage areA. lipids.
    9·2 answers
  • What are the 3 substances which are reabsorbed from the nephron in the blood?
    9·1 answer
  • Segmented animals are ____ symmetrical. Their bodies are divided into repeating parts, or segments. Typically, some of their bod
    6·2 answers
  • Explain the difference in results for the inheritance of the wing and fire-breathing genes vs. the inheritance of the wing and h
    10·2 answers
  • 1. How might a finch population evolve if these tough seeds were the main food source compared to tiny insects?
    6·2 answers
  • PLSSS HELP ME PLSSS I WILL MARK U!!!!<br> Direction: Watch the video and answer the questions below
    14·1 answer
  • In which phase of meiosis II does the cytoplasm divide?
    6·1 answer
  • *50 POINTS* Please write it like "The reaction in this experiment is _______________ (exothermic OR endothermic) because _______
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!