1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rus_ich [418]
3 years ago
5

2

Biology
1 answer:
Ann [662]3 years ago
3 0

Answer:

The cells wouldn't be able to photosynthesize

Explanation:

Chloroplasts absorb light energy, enabling photosynthesis. if they are damaged then the plant can't get light energy.

You might be interested in
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
Goodmorning I can’t seem to remember the question
Alenkasestr [34]

Answer:

d) Protein

Chromatin fibres are wrapped around special proteins called Histones

Hope it helps you

And pls mark it as the brainliest answer

7 0
2 years ago
If your total blood volume is 5 L the volume in your veins and venules is:______a. 3Lb. 3Lc. 1Ld. 5L
Oksi-84 [34.3K]

Answer:

A and B

Explanation:

That's about 3L because at any given time the viens hold about 70% of blood because they have thinner and less rigid walls so 0.7*5 is about 3L

3 0
3 years ago
What should be the role of zoologist in helping to resolve these issues ?
AysviL [449]

resolve what issues..


4 0
3 years ago
Question 4
alexandr1967 [171]
D. The cell could lyse, because the water concentration outside the cell is 0.6 while inside it’s 0.3, and water flows from high -> low. also the membrane isn’t permeable to the solute so the solute cannot move in or out. Please give this brainliest if this helped!
8 0
2 years ago
Other questions:
  • A species of protozoan-carrying mosquito lives in a meadow. The protozoan, if transmitted to mammal hosts through a bit, can be
    7·2 answers
  • Give examples of the physical components of an ecosystems that can change populations.
    9·1 answer
  • Which of the following has the greatest first ionization energy: Li,Be,B, or C?
    13·2 answers
  • Describe the genetic mutations that you think occurred in the cancer cells that were responsible for the phenotypic differences
    13·1 answer
  • The jimsonweed datura stramonium, normally has 12 chromosomes in the body cells. how many chromosomes will an egg cell of the we
    14·2 answers
  • The ability to replace the wildtype alleles with a knockout allele in mice has enabled researchers to carry out important revers
    9·1 answer
  • Q3: What is the interrelationship between plants, soil and decomposers?<br><br>​
    14·1 answer
  • State the major components of the human respiratory system.​
    15·2 answers
  • Phototropism occurs when a plant bends in the direction of a light source. A common light source is the Sun. The plant hormone a
    8·1 answer
  • Who devised a technique for determining the blood group of a dried bloodstain, which he applied to criminal investigations?.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!