1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
IrinaK [193]
3 years ago
8

In some cats, black coat color (B) is dominant over brown (b) and a striped fur pattern (S) is dominant over a marbled fur patte

rn (s). You rescued a black striped cat from an animal shelter but could not determine its exact genotype. To do so, you mated the cat with a brown marbled cat. The mating produced 3 brown marbled, 2 brown striped, 2 black marbled, and 3 black striped. Immediately, you concluded the genotype of your rescued cat was:
Biology
1 answer:
Oksanka [162]3 years ago
3 0

Answer:

The answer would be BbSs, one dominant and one non-dominant from each parent. Hope that helps! :)

You might be interested in
If each parent has two sets of genes and chromosomes, why do their offspring receive only one set from each parent?
bulgar [2K]

Answer:

Explanation:

porque una persona con dos alelos normales presentará un fenotipo normal, mientras que si las dos copias del gen son el alelo mutado que producen una enfermedad, el fenotipo expresará los síntomas característicos de esa enfermedad.

8 0
3 years ago
Type of response in which physical reactions result from stress
Serjik [45]
The answer is  Chronic<span> Stress</span>
8 0
3 years ago
11. What is not an effect of acid rain?
Katena32 [7]

Answer:

D Causes toxic fumes

Explanation:

5 0
2 years ago
Animals that have thick fur and ae able to store large amounts of body fat live where ?
Sergio [31]

Animals that live in temperate woodlands, the Arctic, tundras, and other forest animals such as wolves,, bears, and chipmunks have large amounts of fur and store large amounts of body fur for hibernation purposes.


4 0
3 years ago
What keeps some of the radiation from the sun in the atmosphere
Olegator [25]

Answer:

the ozone layer can do that

Explanation:

3 0
3 years ago
Other questions:
  • What is a string of monosaccharides called?
    13·1 answer
  • Which of the following is the best description of the cane toad’s introduction to Australia?
    15·2 answers
  • In the ocean winds determine what?
    14·2 answers
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • If the gametes produced by a given organism contain 6 chromosomes, how many chromosomes are found in that organism’s body cells?
    14·1 answer
  • Which homeostatic process is characterized by the diffusion of only water molecules?
    12·1 answer
  • Mencione las razones por las cuales el experimento de Pasteur de "Los matraces de cuello de cisne" ayudó a refutar la Teoría de
    14·1 answer
  • Plant cells contain chlorophyll. What is the role of chlorophyll in plant cells?
    13·2 answers
  • some vitamins are mostly found in animal-based foods, while some vitamins are abundant in plant-based foods. the best source of
    13·2 answers
  • Describe the experiment, to show that light intensity, water, chlorophyll, and cabondioxide are needed for photosynthesis
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!