1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kenny6666 [7]
3 years ago
15

Why are scientists concerned about the depletion of the ozone levels in the stratosphere?

Biology
2 answers:
tiny-mole [99]3 years ago
7 0
Because they are scientists...that’s what they do.
Andreyy893 years ago
4 0
Such deterioration allows large amounts of ultraviolet B rays to reach Earth, which can cause skin cancer and cataracts in humans and harm animals as well.
You might be interested in
Draw the life cycle of angiosperms ​
Alex17521 [72]

Answer:

how can we draw that in here?

6 0
3 years ago
Read 2 more answers
a) Name the structures that: i) Carry water and mineral salts to the leaf ii) Prevents too much water loss from the upper surfac
const2013 [10]

Answer:

a) i) Xylem

   ii) Upper epidermis  

   iii) Stoma

   iv) Chroloplast  

   v) Palisade cell layer

b) By a waxy layer on the cuticle of the leaf

Explanation:

The plant's leaves have a large surface area that is capable of absorbing sunlight. The plant's waxy layer in the surface of the leaf protects it from the loss of water, as well as of diseases caused by the entry of microorganisms. The palisade cell's surface is a single layer of cells underneath the upper epidermis that is adapted to absorb light energy.

The waxy layer is a primary physical barrier composed of insoluble polymers and lipids whose function is to protect the leaves against the entry of harmful organisms including virus, bacteria and fungus. Moreover, the plant's waxy cuticle is also a barrier that prevents the loss of water and solutes.

3 0
3 years ago
What kind of variation is exhibited by human bloods?
kotykmax [81]

<span>Blood provides an ideal opportunity for the study of human variation without cultural prejudice.  It can be easily classified for many different genetically inherited blood typing systems.  Also significant is the fact that we rarely take blood types into consideration in selecting mates.  In addition, few people know their own type today and no one did prior to 1900.  As a result, differences in blood type frequencies around the world are most likely due to other factors than social discrimination.  Contemporary Japan is somewhat of an exception since there are popular Japanese stereotypes about people with different blood types.  This could affect choice in marriage partners for some Japanese. </span>All human populations share the same 29 known blood systems, although they differ in the frequencies of specific types.  Given the evolutionary closeness of apes and monkeys to our species, it is not surprising that some of them share a number of blood typing systems with us as well. When we donate blood or have surgery, a small sample is usually taken in advance for at least ABO  and Rh  systems typing.  If you are O+, the O is your ABO type and the + is your Rh type.  It is possible to be A, B, AB, or O as well as Rh+  or Rh- You inherited your blood types from your parents and the environment in which you live cannot change them. I took it from a website: http://anthro.palomar.edu/vary/vary_3.htm

4 0
3 years ago
In the fossil record, there are many species that have remained unchanged. In all geological strata in which they appear, they a
victus00 [196]

Answer:

The given blank can be filed with stasis.

Explanation:

There are various kinds of species that have been discovered in the world and had remained unmodified, that is, right from the start. This has been supported by their fossil records that in the geological strata they were witnessed unchanged. This phenomenon is termed as stasis, in which the species do not exhibit any kind of directional change. The starfish, lungfish, and the tribolates belong to this category, that is, their current time appearance is identical to the fossil records.

7 0
3 years ago
What percentage of wild fires is started by human behavior?
Naya [18.7K]

Answer:

90%

Explanation:

5 0
2 years ago
Other questions:
  • Which structure of a protein is in the amnio acid sequence?
    6·1 answer
  • An organic molecules that is an importanat part of cell membranes is:
    13·1 answer
  • in a forest, a tree falls on a swamp and kills the worm population reducing the population by half. The remaining population is
    11·1 answer
  • How do living things make use of the energy stored in food molecules?
    5·1 answer
  • The consequences of over-fertilization can include ________.
    15·1 answer
  • How does air pollution from combustion engines, industrial processing, and fossil fuels affect the biosphere?
    7·1 answer
  • Consider the status of the black-footed ferret. What is the MOST logical contributing factor to its endangered status? A) The ex
    13·2 answers
  • 9. Which of these are considered standard precautions for dealing with bodily fluids? Check all that apply
    10·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • Plz help me with this....
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!