1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lianna [129]
3 years ago
10

Plastic marine debris was collected from multiple sites in the ocean and examined with electrons microscopy and next Generation

sequencing these techniques revealed microbial communities growing on the plastics. Which of the following statements is correct regarding these communities
Biology
1 answer:
prohojiy [21]3 years ago
5 0
The answer is very much true
You might be interested in
the (blank) Response area is the organelle that is responsible for allowing matter to enter the cell.
matrenka [14]

Answer:

The cell membrane

Explanation:

The cell membrane allows or denies matter from entering the cell while also making sure the inside contents do not escape. This also can be called the plasma membrane.

3 0
3 years ago
Fossils are the. Imprints or traces of once living organisms preserved in rock
kolbaska11 [484]
- Question -

Fossils are the ________, imprints, or traces of once-living organisms preserved in rock.


- Answer -

Remains

Fossils are the remains, imprints, or traces of once-living organisms preserved in rock.


- The Wolf -
8 0
3 years ago
Read 2 more answers
Where is ribosomal RNA made?
viktelen [127]
Ribosomal RNA is made in the centre of the nucleus, the nucleolus. It is a component that makes up the ribosomes along with other specific proteins.
3 0
3 years ago
Why do organisms have to compete for resources
Stolb23 [73]
They have to compete for resources because they need food,air, water and space .
7 0
3 years ago
Which of the following is true for a cell that has a flagellum?
Ad libitum [116K]
The first one is the answer i think dont quote me <span />
6 0
3 years ago
Other questions:
  • Which of the following choices supports a circular economy?
    7·2 answers
  • What is a sex-linked disorder?
    15·2 answers
  • In photosynthesis, electrons that travel through the electron transport chain in the thylakoid membrane come from BLANK . In cel
    12·1 answer
  • Waste management is important for the environment. Waste can cause pollution and disease if it is not handled properly. There ar
    11·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • If all the bees in the hive come from the queen how are they related<br> I NEED AN ANSWER
    11·2 answers
  • Which statement best describes the difference between photosynthesis and
    6·1 answer
  • Question 6<br>Study the following diagram &amp; label it ​
    14·1 answer
  • AG CLASS
    14·1 answer
  • Water molecule, H2O Oxygen molecule, O2
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!