1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Reptile [31]
3 years ago
5

What conclusion can be reached about this data

Biology
1 answer:
Over [174]3 years ago
5 0

Answer:

Explanation:

What data?

You might be interested in
Hi! Could You Help Me? - Pick A Scenario That You Believe Will Have The Greatest Impact On A Food Web In Your Local Ecosystem An
timama [110]
3: Trees are very eco friendly and they are what help us breathe natural air. They have a impact in a pro and con way. Pro, they build more stores, homes, and things we need in those spaces. Con: They are killing our fresh air and we don’t need that. The world is already going through disasters, and we are getting animals extinct.
5 0
3 years ago
Why do populations in different countries grow at different rates?
Lemur [1.5K]
Survival rates of newborns
Average life spans 
Death rates 
level of and access to medicare 
Local diseases with high mortality rates (Malaria,AIDS,Dengue, ETC)
Education levels 
Economic levels
Governmental programs or laws (available food) ECT
Temperature/environment conditions
8 0
3 years ago
A virus uses the _________ and another part puncture the cell.
netineya [11]

*This is to help figure it out, you don't learn if I flat out give you the answer*

The new viruses burst out of the host cell during a process called lysis, which kills the host cell. Some viruses take a portion of the host's membrane during the lysis process to form an envelope around the capsid.

4 0
2 years ago
Determine whether each of the following is a characteristic of the life cycle of a seed plant, a seedless plant, or both. Double
Gnoma [55]

Double fertilization-plants with seeds (flowering plants), two male gametes joining with female gametophyte

Gametophyte generation-both (haploid, sexual stage stage-gametophyte, and the diploid stage that produces spores – sporophyte)

Endosperm formed-plants with seed because it is a tissue formed inside the seed which surrounds the embryo and provides nutrition

Mitosis-both (mitosis occurres in spores)

Spores develop into gametophytes-both but, in seedless plants sporophyte produces spores that will develop into a new organism (multicellular gametophyte) using mitosis, while spores of seed plants are produced internally and develop into more complex structures.


7 0
3 years ago
Explain how humidity ,pressure, and temperature result in cloud cover.
Anarel [89]

Explanation:

Temperature is the amount of heat energy contained in the air, and we measure this in degrees. Air pressure is the amount of pressure exerted by the air in a particular air mass. Humidity is a measure of the water content of the air mass. Clouds are tiny drops of water or ice that form in the atmosphere.

8 0
4 years ago
Other questions:
  • How do hetertrophs make energy ?
    13·2 answers
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • If a eukaryotic cell has 20 chromosomes and it undergoes meiosis ii, how many cells will result, and how many chromosomes will t
    10·1 answer
  • Extra points will give brianliest!!!! IF answered in next 20 mins!
    10·1 answer
  • State four importance of water to organisms in the tropical rainforest.<br>​
    11·1 answer
  • How is a bladder and a water balloon alike
    5·2 answers
  • __________ helps organisms transport nutrients.<br> a. soil<br> b. sap<br> c. water<br> d. wind
    5·1 answer
  • Which of the following describes exploratory analysis?
    13·1 answer
  • In July, Barrow, Alaska (latitude 71.2° N), receives 24 hours of
    6·1 answer
  • How is dna organized in the nucleus when the cell is prepared for division? how is dna organized in the nucleus when the cell is
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!