1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Pavel [41]
3 years ago
7

Over time, what will happen to the population of brown mice that live in a

Biology
1 answer:
Sunny_sXe [5.5K]3 years ago
7 0

Answer:

The population will decrease

Explanation:

The reason it will decrease is that the predators will be able to find the brown mice more easily in the snow then the white mice.

You might be interested in
Back in Darwin's time, people thought that animal species were what?
svet-max [94.6K]
Back in Darwin’s time, people thought that animals sources were a nonhuman ancestors.
8 0
3 years ago
Read 2 more answers
Describe how an invasive species can be introduced into an ecosystem by humans. Name a specific situation and species and how it
oksano4ka [1.4K]

Answer:

Explanation:

Invasive species are animals or plants from another region of the world that don’t belong in their new environment. They can be introduced to an area by ship ballast water, accidental release, and most often, by people. Invasive species can lead to the extinction of native plants and animals, destroy biodiversity, and permanently alter habitats.

4 0
3 years ago
Read 2 more answers
How do the kidneys work to neutralize metabolic acidosis or alkalosis? If metabolic alkalosis exists, the kidneys slow their aci
melomori [17]

Answer:

Attaching letters to the options to make the question readable:

A. If metabolic alkalosis exists, the kidneys slow their acid excretion.

B. If metabolic alkalosis exists, the kidneys slow their acid retention.

C.  If metabolic acidosis exists, the kidneys slow their acid excretion.

D. If metabolic acidosis exists, the kidneys increase their acid retention

The correct answer to the question above is option A (If metabolic alkalosis exists, the kidneys slow their acid excretion.)

Explanation:

Metabolic acidosis is a condition where there is an alteration in the acid-base balance in the blood. Here, as the name implies, a high level of acid than necessary are found in the blood as a product of metabolism caused by an increase in acid production, failure of acid to be expelled in the kidney.  

Metabolic alkalosis is a condition where there is high level of alkaline in the blood than the body requires. Metabolic alkalosis occurs when the kidney is unable to excrete excessive alkaline in the blood and when there is too few acid-producing hydrogen ions present.

Kidneys fight metabolic acidosis by balancing acid levels in the blood by removing excessive acid in the blood through urine. It is also possible for the body to expel volatile acids through the lungs in the form of exhaled air.

Ways kidneys work to neutralize metabolic acidosis, ls If metabolic acidosis exists, the kidneys increase their acid excretion.

Ways kidneys work to neutralize metabolic alkalosis, is If metabolic alkalosis exists, the kidneys slow their acid excretion and increase their alkaline excretion or slow their alkaline retention.

7 0
3 years ago
Hi would it be ok if I could get some help on this question please?
Sophie [7]

Only a small area is opened is the answer.

7 0
3 years ago
Read 2 more answers
Write the main roles of water​
adoni [48]

Answer:

  • Regulates body temperature
  • Flushes bad toxins from body
  • Transports nutrients
  • Essential for digestion
  • Detoxifies
  • Hydrates skin
  • Boosts energy
  • Helps with weight loss
  • Necessary for sanitation
  • Prevents fatigue
  • Improves oxygen delivery to cells
  • Maintains normal electrical properties of cells
3 0
2 years ago
Read 2 more answers
Other questions:
  • When animals hibernate, their heart rate and respiration decrease and they lose consciousness. Why do some animals hibernate?
    6·2 answers
  • How does import of proteins with mitocondrial import sequences affect zfns, talens, and cas9?
    13·1 answer
  • Which number indicates how the moon is seen from earth during the second week of the lunar cycle?
    8·2 answers
  • Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
    6·1 answer
  • What major cellular process do plants and animals (and any organism) need glucose ?
    15·1 answer
  • How does climate change cause the ocean's thermohaline current to slow down?
    6·2 answers
  • Que definición es la que mejor describe a un organismo unicelular y a uno pluricelular
    10·1 answer
  • Please do all for 50 points,<br> please.
    7·1 answer
  • A boy picks up an earthworm and place it on a white tile. He observed that the earthworm has difficulty in moving forward.
    13·2 answers
  • In the Cheseapeake Bay ecosystem, beds of eelgrass provide food and shelter to growing blue crabs. As blue crabs mature, they fe
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!