1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
abruzzese [7]
2 years ago
13

Some types of bacteria can reproduce every 20 minutes under ideal conditions. If a single bacterium begins to reproduce at this

rate, what is the best estimate of how many bacterial cells there will be after 80 minutes?
8
16
40
80
Biology
2 answers:
Murrr4er [49]2 years ago
8 0
Easy
how many times will it double
80/20=4
double 4 times
2*2*2*2=16

16 of them after 80 mins
Vitek1552 [10]2 years ago
6 0

Answer:16

Explanation:

You might be interested in
An animal that eats berries, insects and seeds would be placed in what classification?
GrogVix [38]
The answer is omnivore, because it eats plants and animals 
3 0
2 years ago
Read 2 more answers
For plants living in a dry areas, explain a possible conflict between the need to obtain carbon dioxide for photosynthesis and t
ahrayia [7]

Plants living in dry areas face conflict.

EXPLANATION:

  • Since they live in dry areas they will undergo more transpiration.

  • If they open stomata during the day there will be excessive loss of water vapor that will result in their death.

  • Therefore plants living in this area open the stomata during the night to obtain Carbon dioxide.

  • This checks the loss of water through transpiration and provides the carbon dioxide for photosynthesis.

7 0
1 year ago
Why do you seldom see fossils in metamorphic rocks?
Sergeu [11.5K]

Answer:

Metamorphic rocks have been put under great pressure, heated, squashed or stretched, and fossils do not usually survive these extreme conditions.

Explanation:

8 0
2 years ago
When an environment is hypotonic what happens to the cell?​
Inessa [10]

Answer:

Cells placed in a hypotonic solution will take in water across their membrane until both the external solution and the cytosol are isotonic. A cell that does not have a rigid cell wall, such as a red blood cell, will swell and lyse (burst) when placed in a hypotonic solution.

Explanation:

Hope this helps! Brainly me if you want! <3

4 0
2 years ago
Why are people called people.
Goryan [66]

Answer:

People are call people because a group of human being in a group is call people; we're all people.

Explanation:

4 0
3 years ago
Read 2 more answers
Other questions:
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • What characteristic of radioactive decay makes it useful for determining the absolute age of samples?
    6·2 answers
  • What is a description of cancer?
    10·2 answers
  • Two species are able to breed with each other and produce offspring, but the offspring quickly die. This is a __________________
    14·1 answer
  • Which of these is an example of an oxygen compound?
    12·2 answers
  • In module 1 you learned about homeostasis. what are four ways the skin helps an individual maintain thermoregulation? make sure
    15·2 answers
  • A Bb genotype is homozygous true or false
    8·2 answers
  • an iron ball is heated from 50 degree celsius to 2000 degree celsius. what is the state of the iron ball at 2000 degree celsius
    10·1 answer
  • Which statement describes the epiphyseal plate? It is where flat bones are actively growing. It is where old bone cells are bein
    8·2 answers
  • How do organisms get the energy they need? * 2 points by burning food molecules in their lungs, and releasing their energy as su
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!