1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anit [1.1K]
3 years ago
11

PLS HELP

Biology
2 answers:
gulaghasi [49]3 years ago
7 0

A decomposers ability to cycle nutrients will not become enhanced when there are excessive amounts of nutrients available.

Answer: False

<u>Explanation:</u>

Decomposer is an organism that decomposes the organic matter that is present in the atmosphere. It may be dead and decayed matter or any leftover food material that are biodegradable .

Any organism has a particular tendency to metabolise the nutrients and decompose them, hence when there is excess amount of raw materials their activity does not increase because any organism will become saturated after a point of time and thereby no activity occurs.

lys-0071 [83]3 years ago
5 0
The answer would be TRUE
You might be interested in
Which of the following statements are true about how sunlight photons (solar radiation) and infrared photons (heat) move in Eart
Maksim231197 [3]

Answer:

Explanation:

did u find the answer?

5 0
2 years ago
Scientists find the fossilized remains of a dinosaur in the bottom rock layers of a research site. They find the fossil of a mam
san4es73 [151]
B, the lowest layer is a dinosaur fossil, therefore the mammal fossil was after
7 0
3 years ago
The point beneath the earths surface where rock breaks and an earthquake is produced known as the
Maurinko [17]
Focus because it means <span> the point beneath Earth's surface where rock breaks under stress and can cause an earthquake to happen.</span>
4 0
3 years ago
How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
Mariana [72]

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

6 0
3 years ago
What makes up the inorganic part of soil?
Goshia [24]
The answer is rock and mineral particles bcoz it is only option which is not living thing from start
5 0
3 years ago
Read 2 more answers
Other questions:
  • A __________ is the basic unit of structure and function in living organisms.
    10·2 answers
  • Why was the rearing of marine species in tank aquaculture so difficult before yonathan zohar figured out how to do it?
    12·1 answer
  • An earthworm crawled toward a rock at 14 millimeters per second. At that velocity, how long
    6·1 answer
  • Typical minerals in Felsic igneous rocks are?
    15·2 answers
  • The U.S. Congress is in which branch of government?
    9·2 answers
  • Bacteria is used to produce human insulin because their reproduction is *
    8·1 answer
  • What happens to energy content of substance when is heated?
    15·1 answer
  • List six alternative energy sources.
    14·1 answer
  • Answer the questions below. Will mark the correct answer as brainliest and report irrelevant answers.
    7·1 answer
  • 7. A man with blood type A marries a woman with blood type A. Their first child has blood type o
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!