1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Helen [10]
4 years ago
11

What would happen to a cell if all its enzymes did not work?

Biology
1 answer:
zhenek [66]4 years ago
5 0
The cell would die because it needs enzymes to work
You might be interested in
Who was the first person to connect a patient's symptoms to their actual autopsy findings?
Lina20 [59]
The first real dissections for the study of disease were carried out about 300 BCE by the Alexandrian physicians Herophilus and Erasistratus, but it was the Greek physician Galen of Pergamum in the late 2nd century CE who was the first to correlate the patient’s symptoms (complaints) and signs (what can be seen and felt) with what was found upon examining the “affected part of the deceased.” This was a significant advance that eventually led to the autopsy and broke an ancient barrier to progress in medicine.
6 0
3 years ago
If a person consumed a diet containing 2500 kcal, of which 35% came from protein, approximately how many grams of protein would
marysya [2.9K]

Answer:

218.75 grams of protein.

Explanation:

If 2500 protein is consumed and its 35% energy is provided by protein then:

2500÷35×100 =875 kcal would be provided by protein.

As one gram of protein provide 4 kcal of energy:

875÷4 = 218.75 grams of potein would be consumed.

<em>Remeber the calories and kcal for food is same.</em>

6 0
3 years ago
The image above is of a microscope specimen In your answer explain the following:
Shtirlitz [24]

Answer:

I can't see the picture of the cell,!

8 0
3 years ago
To learn how Earth's atmosphere has changed over time, sientists study air bubbles
nirvana33 [79]

Answer:

The answer is D!!!

3 0
3 years ago
Explain how a trait is inherited and what causes it to vary among individuals​
ddd [48]

Answer:

dominant and recessive gene... i think

6 0
2 years ago
Other questions:
  • What was the result when Morgan mated fruit flies with the genotype XrXr and XrY
    7·2 answers
  • Why are the oldest fossils found in the oldest rock layers?
    11·2 answers
  • If two gray mice mated, what percent of their offspring would have pure white fur?
    11·2 answers
  • All maps _____ a lot more than they include. The decisions about what to include and not include introduce _____.
    11·2 answers
  • Why is a semipermeable membrane necessary for reverse osmosis?
    12·1 answer
  • Select all that apply! Chromosomes _____.
    13·1 answer
  • Which of the following statements best explains the impact deforestation has had on the water cycle
    5·2 answers
  • Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
    6·1 answer
  • What is the purpose of having leak and gated channels for the neuron?
    5·1 answer
  • PLEASE ANSWER FAST I NEED ANSWER
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!