1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
AURORKA [14]
3 years ago
10

In the Punnett square, fill in the shaded boxes with the alleles of each parent. Use B for the

Biology
1 answer:
Liono4ka [1.6K]3 years ago
6 0

Answer: the blue squares are B and the white squares are BB

You might be interested in
Please help me with biology. God bless. (Picture)
Elenna [48]
Amniotic Egg - This type of egg does not require water. Organisms could lay their eggs on land they would not dehydrate.
Lungs - got to be able to extract oxygen from their environment for cellular respiration.<span />
7 0
3 years ago
Warm-Up
Lapatulllka [165]

Answer:

Traits are the genetically determined characteristics that are passed from parents to their offspring.

Explanation:

Traits refer to the characteristics that are present in an organism. These traits are passed from the parents to their offspring in the process of reproduction. When two organisms i. e. male and female of the same specie mate with each other forming a fertile offspring which has some characteristics of their parents. Sometimes, organism is closely related to their father and sometime more characters are transferred to offspring from mother.

6 0
3 years ago
Read 2 more answers
How do sensory receptors send messages to the brain?
dezoksy [38]

Answer:

4

Explanation:

How do (sensory) receptors send messages to the brain?

Via (sensory) neurons

8 0
3 years ago
What does a pyramid of biomass represent? A. Range of food webs found in one trophic level B. Percentage of energy that's passed
Klio2033 [76]

The pyramid of biomass represents a range of food webs found in one trophic level

A pyramid of biomass refers to graphical representation of biomass that is present per unit area of all the various trophic levels of the ecosystem.

<h2>Further Explanation</h2>

The graphical representation shows the relationship between biomass and trophic level that quantify the biomass that is present in each trophic level of energy community at a given period of time.

There are two types of pyramid of biomass, they include

  • Inverted pyramid of biomass  
  • The upright pyramid of biomass  

Inverted pyramid of biomass: a very good example of inverted pyramid can be seen in a case of pond ecosystem, where major producers in the ecosystem (mass of phytoplankton) will be lower than the mass of heterotrophs, such as insects.  

The upright pyramid: The first thing on the upright pyramid is the producers, such as plants. The plants are present at the bottom level of the pyramid and followed by consumers.

Within the pyramid, the highest level is occupied by the carnivores; they are the lowest quantified amount of biomass. In upright pyramid the total weight of the producers is far more than when the weights of all the consumers are combined.  

However, the main issues with the pyramid of biomass are that every trophic level of the pyramid seems to have more energy than it does.

LEARN MORE:

  • pyramid of biomass brainly.com/question/12655542

KEYWORDS:

  • pyramid of biomass
  • trophic level
  • consumers
  • graphical representation
  • ecosystem
8 0
3 years ago
Read 2 more answers
Ecology involves the study of all of the following except for the interactions between
jeka57 [31]
<span>The correct answer is A. atoms. Atoms are studied by physics and chemistry, not by ecology. Ecology studies organisms, populations, and the earth in terms of climate, pollution prevention, natural habitats and biomes, and all kinds of similar things that are related to living on earth. Atoms are irrelevant for the study of ecology.</span>
8 0
3 years ago
Read 2 more answers
Other questions:
  • Two individuals, both with the genotype aabb, produce a number of offspring. the dominant "a" allele masks the effect of the "b"
    9·1 answer
  • Nervous tissue contains specialized cells called
    15·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Wind with the speed of less than 50 km/h is called
    6·2 answers
  • Humans evolved ______billion years after the earth was formed
    7·1 answer
  • The kind of bond that lipids won’t form with water is a _ _ _ _ _ _ _ _ bond.
    9·1 answer
  • Where does sugar enter the blood? where is sugar removed from the blood. Explain how you can tell.
    9·2 answers
  • Help I’ll love u forever
    7·1 answer
  • WRITING FRAME: Elisa’s Diagnosis
    6·2 answers
  • 8. Your mother is sure that you were driving too fast because she knows (2 points)
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!