1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Snowcat [4.5K]
3 years ago
10

For a lab assignment, you are presented with a fungus and are asked to observe and draw conclusions about its reproductive cycle

. During the first hour you notice about 10% of your sample has produced dust-like spores at the tips of its hyphae. After 8 hours, 90% of the sample is producing the spores. You conclude that
Biology
2 answers:
vlada-n [284]3 years ago
4 0
According to the observation, I would conclude that the fungus has asexual form of reproduction.  This is because asexual spores germinate and produce new hyphae anytime and anywhere as long as the conditions are favorable. Sexual pores on the other hand need a time of dormancy after the are formed before they produce more hyphae.
Leno4ka [110]3 years ago
3 0

<u>Answer:</u>

<em>The conclusion from the following experiment is that the fungus is undergoing Asexual mode of reproduction. </em>

<em></em>

<u>Explanation:</u>

The fungus has two types of reproduction i.e. The sexual cycle of reproduction and the Asexual cycle of reproduction.

The Asexual reproduction is carried out by spores. These spores are formed inside the sporangium. They are located either inside or at the tips of the hyphae. These spores are dust like in nature.

So the experimental fungus is undergoing Asexual mode of reproduction.

You might be interested in
List and describe the most important erosional and depositional features of a river and how these features form.
Mkey [24]

Answer:

Meanders

As the river makes its way to the middle course, it gains more water and therefore more energy, so material can be carried in suspension and is used to erode the river banks. Lateral erosion starts to widen the river. When a river flows over flatter land it develops large bends called meanders.

As a river goes around a bend, most of the water is pushed towards the outside. This causes increased speed due to less friction and therefore increased erosion (through hydraulic action and abrasion).

The lateral erosion on the outside bend causes undercutting of the river bank to form a river cliff.

There is less water on the inside bend of a meander so friction causes the water to slow down, lose energy and deposit the material the river is carrying, creating a gentle slope.

The build-up of deposited sediment is known as a slip-off slope (or sometimes river beach).

The fast current on the outside bank causes lateral erosion, creating a river cliff. The slow current on the inside bank causes deposition, creaitng a slip-off slope.

Oxbow lakes

Due to erosion on the outside of a bend and deposition on the inside, the shape of a meander will change over a period of time. Erosion narrows the neck of the land within the meander and as the process continues, the meanders move closer together. When there is a very high discharge (usually during a flood), the river cuts across the neck, taking a new, straighter and shorter route. Deposition will occur to cut off the original meander, leaving a horseshoe-shaped oxbow lake.

Erosion makes the neck narrow. During floods, the river takes the shortest course through the neck. The river has a new straighter course and the abandoned meander is called an oxbow lake.

Explanation:

3 0
3 years ago
In the dna double helix archaic pairs with thymine and cytosine pairs with guanine
zavuch27 [327]

Adenine which is a purine base, always pairs with the pyrimidine Thymine in DNA and Uracil(also a pyrimidine) in RNA. The bond which is present between the two bases is a double hydrogen bond.

Guanine which is also a purine base, always pairs with the pyrimidine Cytosine, in the case of both, DNA and RNA. The bond which is present between the two bases is a triple hydrogen bond and hence, is stronger than the A-G double bond.

3 0
3 years ago
Read 2 more answers
1pt Salts dissociate into component ions when placed in
dexar [7]

Answer:

D. Water

Explanation:

the covalent bonds of water are stronger than the ionic bonds in the salt molecules so they dissolve.

8 0
3 years ago
What does this evidence suggest about the nature of a heart attack?
Svetach [21]
<span>Lactic acids are provided to help the body go without oxygen for a time period</span>
4 0
4 years ago
What was the history of life on earth recorded in?
Doss [256]

Answer: living and fossil organisms evolved

Explanation:

5 0
3 years ago
Other questions:
  • Is there a correlation between heart rate and blood pressure?
    7·1 answer
  • Identify a method scientists use to share information with one another
    8·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Can you guys help me with this question please, and thank you!: Why do you think the breastbone of a bird is so much larger than
    11·1 answer
  • Where does the humoral response happens
    11·1 answer
  • PLEASE HELP/:, BRAINLIEST!<br><br> Are there any maglev cars currently available or being developed
    10·1 answer
  • Maintaining homeostasis keeps the internal environment in the body functioning properly. Many organ systems work together and ma
    10·1 answer
  • In a presentation about measuring mass, one of your classmates states, "Two objects of the same size will always have the same m
    11·1 answer
  • What is the best explanation for extinction of various species?
    10·1 answer
  • Predict what would happen to other organisms in an ecosystem in which all the decomposers went extinct?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!