Step-by-step explanation:
When sea level change happens it can be decreased OR increased. It mostly happens when global temperatures change. Sometimes the ocean freezes, glaciers melt back into the ocean. It changes because of the amount of water being added or decreasing.
C. The digestive system breaks down food and the circulatory system transports the nutrients throughout the body.
The Digestive system is the system that helps the body digest food. It consists of the following organs: liver, stomach, gallbladder, large and small intestines, pancreas, rectum, and esophagus.
The Circulary system is the system that pumps blood through body. The blood contains all the nutrients and minerals the body needs. The system consists of the following organs: heart, blood vessels, blood, lymph, lymphatic vessels, and glands.
Answer:
The microorganisms present metabolic wastes that serve as the primary source of food for other living things.
Bacteria that live free in the soil or in symbiosis with plants are essential to fix nitrogen, both nitrates and ammonia. These bacteria take nitrogen directly from the air, originating compounds that can be incorporated into the composition of the soil or living beings.
This property is restricted only to prokaryotes and is widely distributed among different groups of bacteria and some archaeobacteria. It is a process that consumes a lot of energy that occurs with the mediation of the enzyme nitrogenase, which the rest of the living organisms that cannot do or comply with this process is because they lack said enzyme.
Dunaliella is a genus of microscopic algae of the Chlorophyceae class and of the order Volvocales. All are unicellular, although with very varied morphologies.
Morphologically, its main characteristic is that they lack a rigid polysaccharide cell wall.
The ecology of this genus of green algae is characterized by its high tolerance to salinity, with eukaryotic organisms having greater tolerance to salt. They are euryhaline, adapted to salt concentrations from 50 mM NaCl to almost 5.5 M NaCl.
Explanation:
By nitrogen fixation is meant the combination of molecular nitrogen or dinitrogen with oxygen or hydrogen to give oxides or ammonia that can be incorporated into the biosphere. Molecular nitrogen, which is the majority component of the atmosphere, is inert and not directly usable by most living things. Nitrogen fixation can occur abiotic (without the intervention of living beings) or by the action of microorganisms (biological nitrogen fixation). Fixation in general involves the incorporation into the biosphere of a significant amount of nitrogen, which globally can reach about 250 million tons per year, of which 150 correspond to biological fixation.
Answer:
This condition states that Xander's body temperature is normal. The human feels a little warm. It is due to the various metabolic activities that takes place inside human body.
Not everyone has the same body temperature. The normal body temperature is 38°C. But this can be a bit higher in case of children.
The temperature of the human does not stays same all day. It varies according to the work you do and the time of the day.
Explanation:
Answer:
Write the complementary sequence to the following DNA strand: AATTCGCCGGTATTAGACGTT
TTAAGCGGCCATAATCTGCAA
Explanation:
