1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Andrei [34K]
4 years ago
12

When did biologists confirm that living things are composed of cells?

Biology
2 answers:
lianna [129]4 years ago
5 0
The answer is B.
" The cell was first discovered by Robert Hooke in 1665 using a microscope. The first cell theory is credited to the work of Theodor Schwann and Matthias Jakob Schleiden in the 1830s."
Mumz [18]4 years ago
4 0
The answer is 1830s
You might be interested in
What are the branching, threadlike tubes that make up the bodies of multicellular fungi
o-na [289]
The answer is Hyphae 
If you don't understand plz message me
If you do plz brainlest me
4 0
3 years ago
Read 2 more answers
Are Burmese pythons taking over Florida? Burmese pythons (Python molurus bivittatus) are constricting snakes that can reach enor
LuckyWell [14K]

Answer:

1. It is now illegal to import or purchase Burmese pythons in Florida. Probably, at some point, python owners who no longer wanted to care for them let them go in the Everglades. By the mid-1990s, the pythons had established a breeding population.

2. There have been no human deaths from wild-living Burmese pythons in Florida. Overall, the risk of attack is very low. ... The simplest and most sure-fire way to reduce the risk of human fatalities is to avoid interacting with a large constrictor.

Explanation:

Burmese pythons are not poisonous snakes, however they are constrictors, coiling around their prey and squeezing the life out of it. The officials in the state of Florida are extremely concerned about the invasion of these large snakes and their ability to take over most of the Everglades.

6 0
3 years ago
Read 2 more answers
What would happen to the size of the herbivore population if the producer population decreased?
NNADVOKAT [17]
It would decrease, because the producers are the source of food for the herbivores
5 0
3 years ago
Read 2 more answers
All you need is in the photo ​
jeka57 [31]

Answer:

primary

Explanation:

Primary succession occurs when new land is formed or bare rock is exposed, providing a habitat that can be colonized for the first time. For example, primary succession may take place following the eruption of volcanoes, such as those on the Big Island of Hawaii. As lava flows into the ocean, new rock is formed.

4 0
3 years ago
Why was iodine able to diffuse across the membrane while starch was not?
Vikentia [17]
Starch cannot diffuse across the membrane because starch molecules are too large to fit through the pores in the dialysis tubing, whereas iodine is a smaller molecule and therefore can diffuse across.  
4 0
3 years ago
Read 2 more answers
Other questions:
  • If George is startled by a loud noise immediately after his baby sister cries, he is likely to become fearful every time she cri
    9·2 answers
  • What is the object of mitosis? What mechanism in mitosis allow this to occur?
    9·1 answer
  • What is the meaning of health?
    12·2 answers
  • JOCUL WUOSI SWOIIUM USLUN
    11·1 answer
  • PLEASE HELP!!!!!!!!<br> How does respiration differ from cellular respiration (breathing)?
    12·1 answer
  • How are fats digested in our body? Where does this process take place?( A 5 marker question, pls give a sufficiently long answer
    8·2 answers
  • When blood calcium levels begin to drop below homeostatic levels, ______ is released, causing calcium to be released from bones.
    12·1 answer
  • 675÷ 58010 significant figures ​
    12·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Florida course 3 elevate science book, on page 108, it says is there any matter in figure 1 that you cannot see, what is the ans
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!