1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
NISA [10]
3 years ago
9

Que estrutura presentes no núcleo das células carregam as características que são passadas de pais para filhos

Biology
1 answer:
Olenka [21]3 years ago
7 0
This is SPANISH NOT SCIENCE
You might be interested in
Tell me what are the goals of the c19 vaccine?
WARRIOR [948]

Answer:

to prevent the virus to have a big effect on the body of humans so the cells can fight against it

6 0
3 years ago
Read 2 more answers
If predators A and B prey upon the same species and predator A is eliminated, the population of predator B will likely _________
Allushta [10]

Answer:

Increase

Explanation:

The predator is a type of animal or bird species which kill other animals to obtain its food. The prey is the animal which is killed by the predator. According to the given situation, if the predator species A is eliminated, the population of the predator B will likely increase because there will be no competition between the two species for the same prey. And the chances of predator B obtaining the prey will increase. Hence, the population will increase.

4 0
3 years ago
Read 2 more answers
PLEASE ANSWER THIS QUESTION ASAP!
xenn [34]

Answer:

All answers are in the image

8 0
3 years ago
Steatorrhea is classified as a type of diarrhea
Vlad [161]
It is the gas that comes with diarrhea.
3 0
3 years ago
. Which plane divides the body into upper and lower parts?
LekaFEV [45]
Coronal according to quizlet

5 0
3 years ago
Other questions:
  • Water is regulated by a cells central vacuole. Of what is this an example?
    5·2 answers
  • A neuron transfers information in the form of an electrical impulse true/false
    12·1 answer
  • What is meant by the phrase "Genetic Code"?​
    10·2 answers
  • Which of the following organisms exhibits radial symmetry?
    8·2 answers
  • A lentil plant with spotted seeds was crossed with another that had dotted seeds. The F1 plants turned out to have seeds that ha
    12·1 answer
  • As the concentration of a specific biochemical in a sample increases the intensity measurement for that biochemical decreases. T
    15·1 answer
  • What is the result of cell division?
    14·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • What does a phylogenetic tree represent?
    9·2 answers
  • Identify TWO density-dependent factors that could act as limiting factors for a population. Why are they density-dependent? Plea
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!