Answer:
The earth moves two ways. It spins and it moves around the sun. The spinning of the earth is called rotation. It takes the earth abut 24 hours, or one day, to make one complete rotation.
Explanation:
The earth moves two ways. It spins and it moves around the sun. The spinning of the earth is called rotation. It takes the earth abut 24 hours, or one day, to make one complete rotation.
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
Answer:
5. C. 3 only (Eukaryotic)
7. A. Active Transport
Sorry I am unsure of 9.
Explanation:
Hope those help tho
Yes because as the population of Herons decrease, the population of frogs increase because there is less herons to eat the frogs. If the population of
Answer:
Yes, Lymph is another medium of circulation in the human body
Explanation:
Yes, Lymph is another medium of circulation in the human body. Lymph is part of lymphatic system which in turn is part of the circulatory system. The lymphatic circulatory system comprises of lymphatic vessels which carry clear fluid "lymph" towards the heart. The flow however is unidirectional