1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
omeli [17]
3 years ago
5

Which unit rate is the lowest price per ounce? Choice A: 5 ounces of raisins for $1.49 Choice B: 12 ounces of raisins for $3.59

Choice A Choice B The unit rates are equal. The unit rates cannot be determined.
Mathematics
2 answers:
hoa [83]3 years ago
7 0
5 oz for 1.49.....1.49/5 = 0.298 per oz
12 oz for 3.59...3.59/12 = 0.299 per oz

when rounded, the unit rates are equal
Delvig [45]3 years ago
5 0

Answer:

Choice A  is the lowest price per ounce

Step-by-step explanation:

Choice A: 5 ounces of raisins for $1.49

Cost of 5 ounces of raisins = $1.49

Cost of 1 ounce of raisins = \frac{1.49}{5}

                                         = 0.298

Unit rate =$ 0.298

Choice B: 12 ounces of raisins for $3.59

Cost of 12 ounces of raisins = $3.59

Cost of 1 ounce of raisins = \frac{3.59}{12}

                                         = 0.299

Unit rate =$0.299

Hence  Choice A  is the lowest price per ounce

You might be interested in
What is the prime factorization of 58
Pepsi [2]
The prime factorisation for 58 is 2 x 29

:)
5 0
3 years ago
Read 2 more answers
100 members of a Gym are surveyed. The results are shown below. Given the gym member chosen at random is a female, what is the p
Lina20 [59]

Answer:

\frac{17}{28}

Step-by-step explanation:

There are 56 females

There is 56 females

34 are 20+

34/56 simplfies to 17/28

8 0
3 years ago
The quotient is 71 2/3 what is the divisor
Genrish500 [490]
The divisor is 3.
It is 3 because to make the whole number and the remainder a mixed number you take the whole number then for the numerator you write what is left over(remainder) and for the denominator you will write the divisor. In this case the denominator is 3 so the divisor is 3.

Hope I helped ! :D 
4 0
3 years ago
A spherical balloon is inflating with helium at a rate of 64 pi StartFraction ft cubed Over min EndFraction . How fast is the​ b
olga2289 [7]

Answer:

The radius of the balloon is increasing at a rate of 4 feet per minute.

Step-by-step explanation:

We are given the following in the question:

\dfrac{dV}{dt} = 64\pi \dfrac{\text{ ft}^3}{\text{min}}

Volume of sphere is given by

V = \dfrac{4}{3}\pi r^3

where r is the radius of the balloon.

Instant radius, r = 2 ft

Rate of change of volume =

\dfrac{dV}{dt} = \dfrac{d}{dt}(\dfrac{4}{3}\pi r^3)\\\\\dfrac{dV}{dt} =4\pi r^2\dfrac{dr}{dt}

Putting values, we get,

64\pi = 4\pi (2)^2\dfrac{dr}{dt}\\\\\Rightarrow \dfrac{dr}{dt} = 4

Thus, the radius of the balloon is increasing at a rate of 4 feet per minute.

5 0
3 years ago
When each side of an equation has been simplified, equations that have BLANK coefficients and BLANK constants on each side have
kobusy [5.1K]

Answer:

The answer is below

Step-by-step explanation:

An equation shows the relationship between two or more variables. An equation is a statement that shows the equality between expressions. An equation with infinitely many solution is when all numbers are solutions, that is there is no one solution. Example is: x + 3 = x + 3.

When each side of an equation has been simplified, equations that have the same coefficients and the same constants on each side have infinitely many solutions

7 0
3 years ago
Other questions:
  • The area of a certain desert​ (Desert 1) is nine times the area of another desert​ (Desert 2). If the sum of their areas is 40,0
    15·1 answer
  • Which statement regarding the dismal ram is true?
    10·1 answer
  • The spending habit that will lead too the worst financial situation is to?
    15·1 answer
  • WHEN PARKING NEAR A CORNER YOU MAY PARK YOUR VEHICLE NO CLOSER THAN HOW MAY FEET?
    14·2 answers
  • A ballet company has 30 dancers. They want to randomly sample 8 dancers to complete a survey.
    5·2 answers
  • If ABC is reflecting across the y-axis ,what are the coordinates of c’?
    9·2 answers
  • John book has an area of 88 square inches. What are the length and wide measurements of the book
    9·2 answers
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • Simplify the expression.
    8·2 answers
  • A hot air balloon went from an elevation of 5,038 feet to an elevation of 3,403 feet in 30 minutes. What was its rate of descent
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!