1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
IrinaVladis [17]
3 years ago
10

You just saw a video ad that shows a man talking about the diet pill he uses. He doesn’t appear to be reading a script, and the

words at the bottom of the screen tell you he is not an actor. What technique has the advertising company used to persuade you to use the diet pill? Bandwagon Plain folks Scientific evidence Glittering generalities
Health
2 answers:
atroni [7]3 years ago
8 0
The answer is Plain Folks.

This is commonly used for advertising, for losing weight, pills, diets and even more.
LekaFEV [45]3 years ago
3 0

Answer:

Plain folks

Explanation:

You might be interested in
An enzyme is used to unzip they dna 3'ACTGTACCCATGTGTACTGCCC 5' explication​
s2008m [1.1K]

Answer:

With an eye toward understanding DNA replication, Cornell researchers have learned how a helicase enzyme works to actually unzip the two strands of DNA. The results are published in the journal Nature. At the heart of many metabolic processes, including DNA replication, are enzymes called helicases.

Hope it helps?

Explanation:

5 0
3 years ago
Nandipa wishes to maintain her heart health, strictly follows a plant-based diet, and has successfully maintained her blood leve
nignag [31]

Answer:

The correct answer is B: The benefit of HDL is strictly due to its effect on LDL levels

Explanation:

A: HDL is a 'good' cholesterol. The role of HDL is to 'pick' excess cholesterol and transport it to liver where it is metabolized. Although this statement might be true but its irrelevant to this question hence option A is incorrect.

B: It is important to keep in mind that food that increases HDL levels doesnt decrease the blood LDL levels.If LDL levels are in control only then icreased HDL levels will benefit. Hence option B is true.

C: This option is irrelevant to the question

D: This option too is irrelevant, as we are not concerned about the plant based diet right now as Nandipa is already taking one.

E: Again this point doesnt govern whether she should include food that increases HDL levels. Hence this option is also irrelevant/incorrect

6 0
3 years ago
Which of the following is responsible for issuing licenses for healthcare professionals?
neonofarm [45]
State and Federal Government 
6 0
4 years ago
Read 2 more answers
In order to make healthy choices you need to_____a. ignoreb. advocate forc.evaluated. take more
AfilCa [17]
<span>In order to make healthy choices you need to evaluated. </span>
6 0
3 years ago
When you rate or analysis the consequences of your decision, HELP can assist you with which of the following?
PolarNik [594]

adfhadfgafjsfasdfueat

6 0
3 years ago
Other questions:
  • Peter follows a vegan diet. He feels tingling in his hands and feet and often experiences bouts of depression. Which vitamin def
    13·1 answer
  • When a mediator guides the mediation process, but does not express an opinion, this is called _______ mediation.
    10·2 answers
  • Which of these are possible negative consequences of early sexual activity? Select the three correct answers. A. Improved emotio
    8·2 answers
  • 1. What is an organization's most valuable commodity?
    12·1 answer
  • linda finds herself being short of breath even after light physical activity. the doctor wants to check her breathing rate. whic
    6·2 answers
  • In recognition of the post-purchase role of promotion, what strategies would you suggest for the following: (a) a busy hospital
    6·1 answer
  • Please help you’ll earn 15 points!
    8·1 answer
  • Why were females held from sports in the early 1900s
    14·2 answers
  • Identify 4 function of the body​
    15·1 answer
  • Three additional effects of alcohol that are not related to the body
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!