1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
a_sh-v [17]
3 years ago
13

Who would the double pour technique be a preferred method of fabricating a cast/study model

Biology
1 answer:
vodomira [7]3 years ago
4 0

Answer:

Prevents distortion

Explanation:

Double-pouring technique is used for casting, it prevents distortion of the material to be fabricated or the study model.

It ensures the study or fabricated model is firmly withheld, increasing the material life span, and can be used at extreme conditions.

This type of technique takes longer time to set than the single pour method as it gives the needed base to yeild the oral structures.

You might be interested in
How does cardiorespiratory endurance affect physical fitness? It increases the efficiency with which the body delivers oxygen an
vichka [17]
The best answer to the question above would be the first statement. Cardiorespiratory endurance affects physical fitness in such a way that it increases the efficiency with which the body delivers oxygen and nutrients to its cells.
3 0
3 years ago
Read 2 more answers
One Isotope has 6 protons and 8 neutrons.
djverab [1.8K]
The answer is carbon -6
8 0
3 years ago
Which of the following is responsible for the decline in the population of marine iguanas? Invasive species are preying upon the
baherus [9]
one reason for the decline inthe population of marine iguqnes is that invasive speciesnare preying upon themvand there eggs hope this helps
7 0
3 years ago
What pigment traps the energy?
Brrunno [24]
The green pigment traps energy
6 0
3 years ago
The vertical stem, leaves and flowers of a plant are all plant organs. These organs make up
velikii [3]
The seven processes of life?
6 0
3 years ago
Read 2 more answers
Other questions:
  • Why can only traits controlled by genes be acted upon by natural selection?
    10·1 answer
  • . For the following give the mRNA, tRNA and amino acid (a.a.) sequence that will be created:
    9·1 answer
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • In seedless plants, a fertilized egg will develop into _____.
    10·1 answer
  • Which characteristics must an object possess in order to be considered alive?
    12·1 answer
  • Which of the following terms describes a set of chemical reactions used by the cell to build up and break down molecules necessa
    9·2 answers
  • TRUE/FALSE
    5·2 answers
  • HELP ASAPPPP
    8·2 answers
  • If the mystery food is tofu, then... because...
    6·1 answer
  • How many grams of CO2 are formed when 10g of CaCO3 decomposes?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!