1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
yanalaym [24]
3 years ago
15

HELP ME PLZZZZZZZZZZZZ

Biology
1 answer:
Zarrin [17]3 years ago
7 0
I think it’s B since a flowchart is to help ppl understand how a progress work in steps from the beginning to the end.
You might be interested in
Non-living things that affect living things
VMariaS [17]

Answer:

3) Ecology

Explanation:

Ask ya teacher:P

3 0
3 years ago
Read 2 more answers
A coiled structure of DNA and protein that forms in the cell nucleus during cell division is
Mademuasel [1]

Answer:

true

Explanation:

4 0
3 years ago
Read 2 more answers
When a motor neuron and the skeletal muscle cell it innervates are at rest:?
Nuetrik [128]

<span>Particularly the skeletal muscles at rest gain most of their energy from the aerobic respiration of fatty acids. Hence fatty acids provide the majority of the energy for muscle metabolism when a person is exercising at 25% of VO2max. However, the motor neuron is at rest when a neuron is not receiving any input there will be a potential difference. Thus, the potential difference measured when the neuron is inactive and it is caled the resting membrane potential. </span>

3 0
3 years ago
Where are the three seismographs used to find the epicenter of this earthquake located?
8090 [49]

Scientists use triangulation to find the epicenter of an earthquake. When seismic data is collected from at least three different locations, it can be used to determine the epicenter by where it intersects. Every earthquake is recorded on numerous seismographs located in different directions. Each seismograph records the times when the first (P waves) and second (S waves) seismic waves arrive. From that information, scientists can determine how fast the waves are traveling. Knowing this helps them calculate the distance from the epicenter to each seismograph.

To determine the direction each wave traveled, scientists draw circles around the seismograph locations. The radius of each circle equals the known distance to the epicenter. Where these three circles intersect is the epicenter.


7 0
3 years ago
Read 2 more answers
How does wilted plant "drink" water<br><br> help asap uwu ! &lt;3
TEA [102]

Answer:

When it needs water it will release oxygen into the atmosphere. That makes more room for water and it can suck it up.

Explanation:

7 0
3 years ago
Read 2 more answers
Other questions:
  • What best describes the relax action?
    5·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Why is it increase in the number of a mitochondria beneficial of aerobic exercise?​
    11·1 answer
  • 1. Which of the following is an accurate description of mitosis and meiosis? A. Mitosis produces two diploid daughter cells, whi
    13·2 answers
  • Which of the following statements is true regarding specialization among cells?
    13·2 answers
  • In cell A, what is the structure labeled X?
    5·1 answer
  • In what direction do all arteries carry blood​
    14·2 answers
  • Cell types have in common
    8·1 answer
  • Which of the following is not a characteristic of a mineral?
    9·1 answer
  • The Small channels of spongy bone that are filled with marrow are most accurately named ______.
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!