1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Genrish500 [490]
3 years ago
8

Comparative morphology ______.

Biology
1 answer:
Ivanshal [37]3 years ago
4 0

Answer: analysis the similarities and differences between organisms of the same species

Explanation:

Comparative morphology is analysis of the patterns of the locus of structures within the body plan of an organism, and forms the basis of taxonomical categorization. Functional morphology is the study of the relationship between the structure and function of morphological features.

You might be interested in
DNA is found in the nucleus of eukaryotic cells and the ribosomes, the location where proteins are made, are found out in the cy
Reika [66]

Answer:

See the answer below

Explanation:

<em>The DNA of eukaryotic organisms being present in the nucleus while the protein-synthesizing organelle, the ribosome being present in the cytoplasm poses a spatial problem. It means that transcribed DNAs (messenger RNA) in the nucleus would have to somehow be transported to the ribosome in order for the cell to successfully synthesize proteins.</em>

The problem of transporting the messenger RNA is solved by two features of the cell:

  • The presence of pores in the nuclear envelop
  • The presence of transport proteins in the nucleus

<u>The mRNA binds to the transport proteins to form mRNA-protein complexes and is transported through the nuclear pores, often with the assistance of ATP. </u>

3 0
3 years ago
Plz it will help me alot​
Tanzania [10]

Answer:

Physical trauma, acute disease, chronic disease, infectious disease and emotional trauma.

Explanation:

Physical trauma, acute disease, chronic disease, infectious disease and emotional trauma are the ways from which health should be affected by happening of natural disasters such as earthquake and cyclones. We are able to predict the weather with the help of satellites that monitors the movement of clouds on the earth atmosphere. Advancement of technology is the main reason which enable us to predict the weather conditions as well as the coming of cyclones in a specific region.

4 0
3 years ago
The presence of a specific trait is genetically inherited. There are only two possible outcomes for this trait: an individual ei
Virty [35]
Each parent contributes one allele for this trait.
5 0
3 years ago
The mechanism that breaks the linkage between linked genes is
gregori [183]

Answer:

Crossing over

Explanation:

Crossing over is the process during which two chromatids of two homologous chromosomes exchange part of their genetic segments. It occurs during the pachytene stage of prophase I of meiosis I.

Linked genes are mostly inherited together and do not exhibit independent assortment. However, when linked genes are present far apart from each other on the same chromosome, crossing over can occur between them to produce recombinant chromatids. Therefore, crossing over can break the linkage and produce recombinant progeny as it occurs during the independent assortment of unlinked genes.

8 0
3 years ago
predict the correct order of the following, from first to last, AND EXPLAIN WHY YOU CHOSE THAT ORDER! - (protein, RNA, traits, D
inysia [295]
DNA, RNA,Protein,Trait

The DNA is transcribed into the RNA during the process 'transcription'. Then, RNA is later translated into proteins during the process 'translation'. Then the protein is turned into traits.
3 0
3 years ago
Other questions:
  • Suppose a BB female mouse mates with a Bb male mouse. Which of the following represents the probabilities of each genotype occur
    6·1 answer
  • What are limitations of coal as a source of energy ?
    5·1 answer
  • It's multiple choice
    12·1 answer
  • 1. Name two types of bonds.
    11·2 answers
  • Based on the fossil, which organism evolved first
    6·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Someone is doing a research project and decided to leave out many organelles in the cell because they say they are not important
    7·2 answers
  • 1) Explain why increasing the amounts of the two enzymes changed the life spans of the mice.
    8·2 answers
  • During the process shown above, the two strands of one DNA molecule are unwound. Then, DNA polymerases add complementary nucleot
    9·1 answer
  • .................................
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!