Ask question

Ask question

All categories

2 years ago

10

Animal wastes that runoff into water is an example of which types of pollution? question 3 options: bacterial & chemical nut

rient & bacterial chemical & sediment sediment & nutrient

1 answer:

Ira Lisetskai [31]2 years ago

4 0

Sediment pollution runoff, construction, livestock field, and flooding

You might be interested in

If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix

Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0

2 years ago

If a yellow shirt is under green light what color would the shirt be?

wel

Answer:

the colour of the shirt would be green

3 0

2 years ago

how it would be possible to have a change in a single base of DNA, but have the protein NOT change and be functional

jeka57 [31]

It Wouldn’t necessarily be possible

8 0

2 years ago

Read 2 more answers

To meet cellular needs for food, water, energy, and waste removal, multicellular organisms have developed various _________ spec

damaskus [11]

C is the answer for the problem

6 0

2 years ago

Read 2 more answers

Annual rings in woody stems are caused by an increase in rings of the

Kryger [21]

<span>B.Secondary xylem.
WELCOME :)</span>

3 0

3 years ago