1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Aloiza [94]
3 years ago
13

Frank and his team are building sedimentation ponds to hold runoff water in a landfill. Which component of MSW landfill are they

building?
cell
cover
bottom liner
storm water drainage system
Biology
1 answer:
Liono4ka [1.6K]3 years ago
8 0
The answer is storm water drainage system.

All of the options are components of the landfill but a storm<span><span> water drainage system will allow to hold the runoff watter </span>of the place.
</span>
It will keep the landfill as dry as possible and can be done in two different ways: By excluding liquids that come with solid waste or by k<span>eeping the rainwater out of the landfill.</span>
You might be interested in
Grandpa Sam used to tell his grandkids how he first laid eyes on Grandma Sylvia. “When I was courting your granny, I was dazzled
bonufazy [111]
Long eyelashes is the dominant trait because, in the last sentence, donna mentioned how nearly everyone in the family had long eyelashes, while barbara and her had short ones. this proves that long eyelashes are much more common in the family than short eyelashes, which means long eyelashes would be dominant, while short eyelashes would be recessive.
6 0
3 years ago
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
2 years ago
HELP!!! choose one of the following types of biotechnology: genetic engineering, cloning, or artificial selection. You will then
Darina [25.2K]

Answer:

Genetically modified organisms or GMOs can be characterized as living beings (for example plants, creatures or microorganisms) in which the hereditary material (DNA) has been changed in a way that doesn't happen normally by mating and additionally common recombination. The innovation is regularly called "present day biotechnology" or "quality innovation", now and again likewise "recombinant DNA innovation" or "hereditary designing". It permits chosen singular qualities to be moved from one life form into another, likewise between nonrelated species. Nourishments created from or utilizing GM life forms are regularly alluded to as GM nourishments.  

GM nourishments are created – and promoted – in light of the fact that there is some apparent bit of leeway either to the maker or customer of these nourishments. This is intended to convert into an item with a lower cost, more prominent advantage (regarding toughness or healthy benefit) or both. At first GM seed engineers needed their items to be acknowledged by makers and have focused on advancements that carry direct advantage to ranchers (and the food business by and large).  

One of the destinations for creating plants dependent on GM life forms is to improve crop insurance. The GM crops as of now available are fundamentally focused on an expanded degree of harvest security through the presentation of obstruction against plant infections brought about by creepy crawlies or infections or through expanded resilience towards herbicides.  

Resistance for insects is accomplished by consolidating into the food plant the quality for toxins creation from the bacterium Bacillus thuringiensis (Bt). This poison is presently utilized as an ordinary bug spray in agribusiness and is ok for human utilization. GM crops that inalienably produce this poison have been appeared to require lower amounts of bug sprays in explicit circumstances, for example where nuisance pressure is high. Infection obstruction is accomplished through the presentation of quality from certain infections that cause sickness in plants. Infection opposition makes plants less helpless to sicknesses brought about by such infections, bringing about higher harvest yields.  

Herbicide resilience is accomplished through the presentation of a quality from a bacterium passing on protection from certain herbicides. In circumstances where weed pressure is high, the utilization of such harvests has brought about a decrease in the amount of the herbicides utilized.

5 0
3 years ago
What are three herbivores and carnivores in finding nemo
STALIN [3.7K]
Herbivores: Bubbles (yellow tang), Bruce (turtle), Dory.

Carnivores: The three sharks. Chum (maiko shark), Bruce (great white shark), Anchor (Hammerhead shark).
4 0
3 years ago
Read 2 more answers
What is the smallest unit in biology ?​
erma4kov [3.2K]

Answer:

A cell is the smallest unit of a living thing.

6 0
2 years ago
Read 2 more answers
Other questions:
  • Which statement is not true of endothermic animals?
    14·1 answer
  • A biologist measures the allele frequencies of pea plants in a very controlled environment. The plants can either have a dominan
    13·2 answers
  • An organisms Genotype can best be defined as a number of chromosome pairs a number recessive genes inherited physical appearance
    8·2 answers
  • What is the specific gravity means and how does specific gravity related to solid materials,
    7·1 answer
  • What the contact between photosynthesis and respiration
    5·1 answer
  • Need help with these questions! Will give brainliest answer/thanks/5 star
    6·1 answer
  • In an experiment designed to test the effect of temperature on goldfish respiration, the temperatures that were changed represen
    7·1 answer
  • Why Floating of ice on water?​
    15·1 answer
  • A. Describe the components of air pollution that are considered greenhouse gases.
    15·1 answer
  • How does meiosis create haploid gametes
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!