1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
3241004551 [841]
3 years ago
9

Pepsin is found in the stomach and Trypsin is in the small intestine. Describe what would occur to the enzyme activity of both e

nzymes if Pepsin was secreted into the small intestine
and trypsin was secreted into the stomach?
Biology
1 answer:
vfiekz [6]3 years ago
6 0

Answer:

If enzyne activity occur if pepsin was secreted into the small intestine and trypsin was secreted into stomach you would be in pain or vomit.  

Explanation:

Because you can´t put those chemicals together or it will cause a chemical reaction.

You might be interested in
After fertilization, the cell begins to divide by mitosis. which statement describes what occurs with the chromosomes?
MAXImum [283]
During mitosis the chromosomes are being duplicated. which means the chromosomes that are formed during the mitosis is identical to its parents. during the mitosis, the cell udergoes 4 phases. prophase, metaphase, anaphase and lastly the telophase
7 0
3 years ago
What is another name for observations
Dominik [7]
A synonym for observation could be remark. 
3 0
3 years ago
Read 2 more answers
What does a reviewer do during peer-review?
matrenka [14]
Corrects a persons errors they made
Hope this helped!
5 0
3 years ago
Read 2 more answers
Sally sustained damage to some autonomic ganglia. What part of the visceral reflex arc is interrupted
AnnZ [28]

The part of the visceral reflex arc that is interrupted is the motor response in a target cell.  The visceral reflex is part of the autonomic nervous system (ANS).

The visceral reflex arc refers to the reflex arc present in the autonomic nervous system (ANS).

This reflex arc (visceral reflex) generates glandular muscular (motor) responses within internal organs.

The visceral nervous system controls different body functions including, among others, digestion, respiratory rate, heart, pupillary dilation, etc.

Learn more about the visceral reflex arc here:

brainly.com/question/25698063

7 0
2 years ago
Respiration involves a reaction between oxygen and ____.
Elan Coil [88]
The most appropriate answer is D !

in respiration oxygen and glucose( food substance) combines to form energy and CO2 !
7 0
3 years ago
Read 2 more answers
Other questions:
  • The principle difference between where salt marshes and mangrove forests grow is _______.
    14·1 answer
  • if there were no suppression of dna replication between meiotic divisions but cytokinesis proceeded normally, what is the most l
    6·1 answer
  • 11.1 The Work of Gregor Mendel Lesson Objectives Describe Mendel’s studies and conclusions about inheritance. Describe what happ
    14·1 answer
  • Is a enzyme and protein the same thing or different
    11·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Which field of biology is the study of organisms interacting with their environment
    11·2 answers
  • Because the cell membrane is made of two layers of lipids it is called a..?
    12·1 answer
  • Pls !<br> Help!<br> How does the length of interphase compare to the length of cell division?
    8·1 answer
  • What kind of energy would a textbook lose if you dropped it off of a building?
    13·2 answers
  • Please answer this for me​
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!