The correct answer is C) There is not enough oxygen in the culture medium. This is because of alcoholic fermentation, and anaerobic process where the yeast transform sugar (glucose) in ethylic alcohol (ethanol) and carbon dioxide. Glucose is decomposed into pyruvic acid which then after turns into CO2 and ethanol. The bubbles described, are produced by the carbon dioxide.
The yeast, as well as some bacteria, use the glucose molecule through "glycolysis" to obtain a 3-carbon molecule called pyruvates. Glycolysis consists of 10 coupled reactions, in the end, from one glucose (6 carbons) the yeast will obtain two pyruvates (3 carbons each).
Pyruvate can follow three main routes to obtain ATP, end up as lactate, as carbon dioxide (CO2) and water or as ethanol (alcohol) and CO2. Regarding yeast, it can only be used to obtain Ethanol plus CO2 or to obtain CO2 plus water.
The path that follows from here depends on the reaction medium. The cell gets much more energy (38 molecules of ATP) by converting pyruvate into water + CO2 than by turning it into ethanol + CO2 (2 molecules of ATP). Then, whenever possible, the yeast will follow the CO2 + water path. To support this route the cell needs oxygen. In this case, the cell obtains its energy by breathing when there is no oxygen available, the yeast has a way that allows it to gain much less energy but allows it to survive, the alcoholic fermentation, previously mentioned.
Therefore, A, B, and D answers are wrong for the reasons mentioned above.
Answer:
Actually, it’s not the DNA itself cannot leave the nucleus, but the Chromosome or Chromatin. Because, in the nucleus, DNAs are folded into Chromatin or Chromosome. Chromatin or Chromosome just like a rope, and the DNA just the fiber. It’s the rope cannot escape from the nucleus instead of the fibers.
Explanation:
Answer:
Explanation:
They have a much higher range of magnification (can detect smaller structures)
They have a much higher resolution (can provide clearer and more detailed images)
hope that help you
Answer:
All living things are made up of one or more cells.
Explanation:
The cell theory is a universal theory proposed by three scientists viz: Theodor Schwann, Mathias Scleiden, and Rudolf Virchow in the year 1838. These three scientists contributed to the cell theory and proposed the following:
1) All living things are composed of one or more cells
2) Cell is the basic and fundamental unit of life
3) New cells arise from pre-existing cells.
However, at an earlier date specifically 1665, an English scientist named Robert Hooke has discovered and coined the term "cells" in his published book by observing a piece of cork under a microscope. This Hooke's discovery of cells from a once living cork best supports the part of the cell theory that states that: All living things are made up of one or more cells.
Answer:
The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.
Explanation:
Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.
If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:
<u>Exercise 1:</u>
- DNA ATACGAAATCGCGATCGCGGCGATTCGG
- mRNA UAUGCUUUAGCGCUAGCGCCGCUAAGCC
- CODON UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
- AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
- Amino acid Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser
<u>Exercise 2: </u>
- DNA TTTACGGCCATCAGGCAATACTGG
- mRNA AAAUGCCGGUAGUCCGUUAUGACC
- CODON AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
- AntiCODON UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
- Amino acid Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
